ID: 926593106

View in Genome Browser
Species Human (GRCh38)
Location 2:14760371-14760393
Sequence CTGGGGTCGCCTCAGGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926593106_926593115 -2 Left 926593106 2:14760371-14760393 CCGGGAGCCTGAGGCGACCCCAG No data
Right 926593115 2:14760392-14760414 AGGGGCCAGAGAAAAGCAGGTGG No data
926593106_926593113 -5 Left 926593106 2:14760371-14760393 CCGGGAGCCTGAGGCGACCCCAG No data
Right 926593113 2:14760389-14760411 CCCAGGGGCCAGAGAAAAGCAGG No data
926593106_926593118 23 Left 926593106 2:14760371-14760393 CCGGGAGCCTGAGGCGACCCCAG No data
Right 926593118 2:14760417-14760439 CCAGACAGCAGTGCCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926593106 Original CRISPR CTGGGGTCGCCTCAGGCTCC CGG (reversed) Intergenic
No off target data available for this crispr