ID: 926594537

View in Genome Browser
Species Human (GRCh38)
Location 2:14776005-14776027
Sequence AAATATAAGTAGTTGGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926594531_926594537 1 Left 926594531 2:14775981-14776003 CCTACCACCTGCACCAGGAACTA No data
Right 926594537 2:14776005-14776027 AAATATAAGTAGTTGGGATCAGG No data
926594533_926594537 -6 Left 926594533 2:14775988-14776010 CCTGCACCAGGAACTACAAATAT No data
Right 926594537 2:14776005-14776027 AAATATAAGTAGTTGGGATCAGG No data
926594532_926594537 -3 Left 926594532 2:14775985-14776007 CCACCTGCACCAGGAACTACAAA No data
Right 926594537 2:14776005-14776027 AAATATAAGTAGTTGGGATCAGG No data
926594529_926594537 11 Left 926594529 2:14775971-14775993 CCACAAGACACCTACCACCTGCA No data
Right 926594537 2:14776005-14776027 AAATATAAGTAGTTGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926594537 Original CRISPR AAATATAAGTAGTTGGGATC AGG Intergenic
No off target data available for this crispr