ID: 926600064

View in Genome Browser
Species Human (GRCh38)
Location 2:14832721-14832743
Sequence GTTACATGCATATTATTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926600060_926600064 26 Left 926600060 2:14832672-14832694 CCAGCTGGGAAGTTTTCTGTGAG No data
Right 926600064 2:14832721-14832743 GTTACATGCATATTATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926600064 Original CRISPR GTTACATGCATATTATTGCA TGG Intergenic
No off target data available for this crispr