ID: 926601979

View in Genome Browser
Species Human (GRCh38)
Location 2:14855012-14855034
Sequence TTTCTCCTCTAGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926601979_926601985 15 Left 926601979 2:14855012-14855034 CCTTCCACCTGCTAGAGGAGAAA No data
Right 926601985 2:14855050-14855072 GAGAACTTTGTCTTGTATCCAGG No data
926601979_926601984 -9 Left 926601979 2:14855012-14855034 CCTTCCACCTGCTAGAGGAGAAA No data
Right 926601984 2:14855026-14855048 GAGGAGAAAAGAGGGAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926601979 Original CRISPR TTTCTCCTCTAGCAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr