ID: 926604640

View in Genome Browser
Species Human (GRCh38)
Location 2:14885251-14885273
Sequence GAGTAGAGATGGAGAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926604640 Original CRISPR GAGTAGAGATGGAGAGAAAT GGG Intergenic
No off target data available for this crispr