ID: 926607764

View in Genome Browser
Species Human (GRCh38)
Location 2:14914572-14914594
Sequence TTGCAGGAACAGATTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926607754_926607764 15 Left 926607754 2:14914534-14914556 CCCTTGTCAAGGAGCAGTATTTA No data
Right 926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG No data
926607753_926607764 16 Left 926607753 2:14914533-14914555 CCCCTTGTCAAGGAGCAGTATTT No data
Right 926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG No data
926607755_926607764 14 Left 926607755 2:14914535-14914557 CCTTGTCAAGGAGCAGTATTTAG No data
Right 926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG No data
926607751_926607764 21 Left 926607751 2:14914528-14914550 CCCAGCCCCTTGTCAAGGAGCAG No data
Right 926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG No data
926607752_926607764 20 Left 926607752 2:14914529-14914551 CCAGCCCCTTGTCAAGGAGCAGT No data
Right 926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926607764 Original CRISPR TTGCAGGAACAGATTGGGGA GGG Intergenic
No off target data available for this crispr