ID: 926610848

View in Genome Browser
Species Human (GRCh38)
Location 2:14945083-14945105
Sequence GTTCAGCAGCACCAAGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926610847_926610848 -7 Left 926610847 2:14945067-14945089 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG No data
926610845_926610848 5 Left 926610845 2:14945055-14945077 CCAAAGGAGATGCCAAATCAGAG 0: 25
1: 40
2: 53
3: 80
4: 220
Right 926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926610848 Original CRISPR GTTCAGCAGCACCAAGCTGC CGG Intergenic
No off target data available for this crispr