ID: 926615284

View in Genome Browser
Species Human (GRCh38)
Location 2:14991186-14991208
Sequence GTCCCAGCCCTGACTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926615284_926615291 23 Left 926615284 2:14991186-14991208 CCAGCTCTAGTCAGGGCTGGGAC No data
Right 926615291 2:14991232-14991254 CCCTTTCTCCATCAACGGCAGGG No data
926615284_926615289 22 Left 926615284 2:14991186-14991208 CCAGCTCTAGTCAGGGCTGGGAC No data
Right 926615289 2:14991231-14991253 ACCCTTTCTCCATCAACGGCAGG No data
926615284_926615288 18 Left 926615284 2:14991186-14991208 CCAGCTCTAGTCAGGGCTGGGAC No data
Right 926615288 2:14991227-14991249 AACAACCCTTTCTCCATCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926615284 Original CRISPR GTCCCAGCCCTGACTAGAGC TGG (reversed) Intergenic
No off target data available for this crispr