ID: 926615288

View in Genome Browser
Species Human (GRCh38)
Location 2:14991227-14991249
Sequence AACAACCCTTTCTCCATCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926615283_926615288 19 Left 926615283 2:14991185-14991207 CCCAGCTCTAGTCAGGGCTGGGA No data
Right 926615288 2:14991227-14991249 AACAACCCTTTCTCCATCAACGG No data
926615285_926615288 -10 Left 926615285 2:14991214-14991236 CCCAGATCTAACCAACAACCCTT No data
Right 926615288 2:14991227-14991249 AACAACCCTTTCTCCATCAACGG No data
926615284_926615288 18 Left 926615284 2:14991186-14991208 CCAGCTCTAGTCAGGGCTGGGAC No data
Right 926615288 2:14991227-14991249 AACAACCCTTTCTCCATCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926615288 Original CRISPR AACAACCCTTTCTCCATCAA CGG Intergenic
No off target data available for this crispr