ID: 926615291

View in Genome Browser
Species Human (GRCh38)
Location 2:14991232-14991254
Sequence CCCTTTCTCCATCAACGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926615283_926615291 24 Left 926615283 2:14991185-14991207 CCCAGCTCTAGTCAGGGCTGGGA No data
Right 926615291 2:14991232-14991254 CCCTTTCTCCATCAACGGCAGGG No data
926615284_926615291 23 Left 926615284 2:14991186-14991208 CCAGCTCTAGTCAGGGCTGGGAC No data
Right 926615291 2:14991232-14991254 CCCTTTCTCCATCAACGGCAGGG No data
926615285_926615291 -5 Left 926615285 2:14991214-14991236 CCCAGATCTAACCAACAACCCTT No data
Right 926615291 2:14991232-14991254 CCCTTTCTCCATCAACGGCAGGG No data
926615286_926615291 -6 Left 926615286 2:14991215-14991237 CCAGATCTAACCAACAACCCTTT No data
Right 926615291 2:14991232-14991254 CCCTTTCTCCATCAACGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926615291 Original CRISPR CCCTTTCTCCATCAACGGCA GGG Intergenic
No off target data available for this crispr