ID: 926618214

View in Genome Browser
Species Human (GRCh38)
Location 2:15020934-15020956
Sequence TACAAAAAGCTGACCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926618209_926618214 15 Left 926618209 2:15020896-15020918 CCACCACTTACTCAGTGCTTACT No data
Right 926618214 2:15020934-15020956 TACAAAAAGCTGACCTGGCCAGG No data
926618210_926618214 12 Left 926618210 2:15020899-15020921 CCACTTACTCAGTGCTTACTCTG No data
Right 926618214 2:15020934-15020956 TACAAAAAGCTGACCTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926618214 Original CRISPR TACAAAAAGCTGACCTGGCC AGG Intergenic
No off target data available for this crispr