ID: 926619960

View in Genome Browser
Species Human (GRCh38)
Location 2:15038658-15038680
Sequence GTGAACAGTAGGAGGACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926619953_926619960 24 Left 926619953 2:15038611-15038633 CCTCTGACCTTACACTTCTGTGT No data
Right 926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG No data
926619954_926619960 17 Left 926619954 2:15038618-15038640 CCTTACACTTCTGTGTCGTGATG No data
Right 926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926619960 Original CRISPR GTGAACAGTAGGAGGACTTC TGG Intergenic
No off target data available for this crispr