ID: 926620644

View in Genome Browser
Species Human (GRCh38)
Location 2:15043827-15043849
Sequence GAGTCAGAAGGCACCCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926620644_926620653 9 Left 926620644 2:15043827-15043849 CCTTGGAGGGTGCCTTCTGACTC No data
Right 926620653 2:15043859-15043881 CTAGCCTGCCAGGGCTCCCGGGG No data
926620644_926620647 0 Left 926620644 2:15043827-15043849 CCTTGGAGGGTGCCTTCTGACTC No data
Right 926620647 2:15043850-15043872 ATCCCCACACTAGCCTGCCAGGG No data
926620644_926620646 -1 Left 926620644 2:15043827-15043849 CCTTGGAGGGTGCCTTCTGACTC No data
Right 926620646 2:15043849-15043871 CATCCCCACACTAGCCTGCCAGG No data
926620644_926620652 8 Left 926620644 2:15043827-15043849 CCTTGGAGGGTGCCTTCTGACTC No data
Right 926620652 2:15043858-15043880 ACTAGCCTGCCAGGGCTCCCGGG No data
926620644_926620651 7 Left 926620644 2:15043827-15043849 CCTTGGAGGGTGCCTTCTGACTC No data
Right 926620651 2:15043857-15043879 CACTAGCCTGCCAGGGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926620644 Original CRISPR GAGTCAGAAGGCACCCTCCA AGG (reversed) Intergenic
No off target data available for this crispr