ID: 926620684

View in Genome Browser
Species Human (GRCh38)
Location 2:15044250-15044272
Sequence CTGCTACTTACCTGCAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926620684_926620688 -5 Left 926620684 2:15044250-15044272 CCTGATTTGCAGGTAAGTAGCAG No data
Right 926620688 2:15044268-15044290 AGCAGGGAAAGGTCTTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926620684 Original CRISPR CTGCTACTTACCTGCAAATC AGG (reversed) Intergenic
No off target data available for this crispr