ID: 926628694

View in Genome Browser
Species Human (GRCh38)
Location 2:15117724-15117746
Sequence TATCACCAGCTCCAAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926628694_926628698 -6 Left 926628694 2:15117724-15117746 CCCATCCTTTGGAGCTGGTGATA No data
Right 926628698 2:15117741-15117763 GTGATACCAGGAACACAGTGTGG No data
926628694_926628701 9 Left 926628694 2:15117724-15117746 CCCATCCTTTGGAGCTGGTGATA No data
Right 926628701 2:15117756-15117778 CAGTGTGGGAAACGCTGCACTGG No data
926628694_926628699 -5 Left 926628694 2:15117724-15117746 CCCATCCTTTGGAGCTGGTGATA No data
Right 926628699 2:15117742-15117764 TGATACCAGGAACACAGTGTGGG No data
926628694_926628702 10 Left 926628694 2:15117724-15117746 CCCATCCTTTGGAGCTGGTGATA No data
Right 926628702 2:15117757-15117779 AGTGTGGGAAACGCTGCACTGGG No data
926628694_926628703 11 Left 926628694 2:15117724-15117746 CCCATCCTTTGGAGCTGGTGATA No data
Right 926628703 2:15117758-15117780 GTGTGGGAAACGCTGCACTGGGG No data
926628694_926628704 18 Left 926628694 2:15117724-15117746 CCCATCCTTTGGAGCTGGTGATA No data
Right 926628704 2:15117765-15117787 AAACGCTGCACTGGGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926628694 Original CRISPR TATCACCAGCTCCAAAGGAT GGG (reversed) Intergenic
No off target data available for this crispr