ID: 926629054

View in Genome Browser
Species Human (GRCh38)
Location 2:15120150-15120172
Sequence TGTACCTCTTAAAACCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926629047_926629054 30 Left 926629047 2:15120097-15120119 CCTTAAAACAGGAAGTGTGGGAG No data
Right 926629054 2:15120150-15120172 TGTACCTCTTAAAACCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926629054 Original CRISPR TGTACCTCTTAAAACCTGTC TGG Intergenic
No off target data available for this crispr