ID: 926629402

View in Genome Browser
Species Human (GRCh38)
Location 2:15123089-15123111
Sequence CTCCCAGGCTACCTCGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926629402_926629411 21 Left 926629402 2:15123089-15123111 CCCACCCCGAGGTAGCCTGGGAG No data
Right 926629411 2:15123133-15123155 CCCAGCATGCTGAGTCATCCTGG No data
926629402_926629409 -4 Left 926629402 2:15123089-15123111 CCCACCCCGAGGTAGCCTGGGAG No data
Right 926629409 2:15123108-15123130 GGAGCAGCAGGCTTTCGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926629402 Original CRISPR CTCCCAGGCTACCTCGGGGT GGG (reversed) Intergenic
No off target data available for this crispr