ID: 926630206

View in Genome Browser
Species Human (GRCh38)
Location 2:15128993-15129015
Sequence GGTTTGAGCAGGGGGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926630197_926630206 -1 Left 926630197 2:15128971-15128993 CCAGGAAATGTGTGGAGCCGCTG No data
Right 926630206 2:15128993-15129015 GGTTTGAGCAGGGGGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926630206 Original CRISPR GGTTTGAGCAGGGGGCTGGG CGG Intergenic