ID: 926634201

View in Genome Browser
Species Human (GRCh38)
Location 2:15163287-15163309
Sequence GAGTGGGACTAGAAGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926634192_926634201 0 Left 926634192 2:15163264-15163286 CCGCTTCCCAGCAGGCCTTTCCA No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data
926634195_926634201 -7 Left 926634195 2:15163271-15163293 CCAGCAGGCCTTTCCAGAGTGGG No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data
926634186_926634201 16 Left 926634186 2:15163248-15163270 CCAAGTCCAGCATCCCCCGCTTC No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data
926634187_926634201 10 Left 926634187 2:15163254-15163276 CCAGCATCCCCCGCTTCCCAGCA No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data
926634189_926634201 3 Left 926634189 2:15163261-15163283 CCCCCGCTTCCCAGCAGGCCTTT No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data
926634191_926634201 1 Left 926634191 2:15163263-15163285 CCCGCTTCCCAGCAGGCCTTTCC No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data
926634190_926634201 2 Left 926634190 2:15163262-15163284 CCCCGCTTCCCAGCAGGCCTTTC No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data
926634185_926634201 21 Left 926634185 2:15163243-15163265 CCAAGCCAAGTCCAGCATCCCCC No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data
926634193_926634201 -6 Left 926634193 2:15163270-15163292 CCCAGCAGGCCTTTCCAGAGTGG No data
Right 926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926634201 Original CRISPR GAGTGGGACTAGAAGGGAGA AGG Intergenic
No off target data available for this crispr