ID: 926634611

View in Genome Browser
Species Human (GRCh38)
Location 2:15166156-15166178
Sequence GGGAACACCCCTTGTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926634602_926634611 2 Left 926634602 2:15166131-15166153 CCTGGGACCCTTATCCTCCATCA 0: 1
1: 0
2: 3
3: 18
4: 148
Right 926634611 2:15166156-15166178 GGGAACACCCCTTGTGTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 101
926634606_926634611 -6 Left 926634606 2:15166139-15166161 CCTTATCCTCCATCACAGGGAAC 0: 1
1: 0
2: 2
3: 13
4: 165
Right 926634611 2:15166156-15166178 GGGAACACCCCTTGTGTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 101
926634600_926634611 16 Left 926634600 2:15166117-15166139 CCAGCAAGCTATGCCCTGGGACC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 926634611 2:15166156-15166178 GGGAACACCCCTTGTGTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 101
926634605_926634611 -5 Left 926634605 2:15166138-15166160 CCCTTATCCTCCATCACAGGGAA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 926634611 2:15166156-15166178 GGGAACACCCCTTGTGTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 101
926634601_926634611 3 Left 926634601 2:15166130-15166152 CCCTGGGACCCTTATCCTCCATC 0: 1
1: 0
2: 0
3: 21
4: 160
Right 926634611 2:15166156-15166178 GGGAACACCCCTTGTGTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926634611 Original CRISPR GGGAACACCCCTTGTGTGGG AGG Intergenic
900517487 1:3089773-3089795 TGGAACATCCCTGGTGCGGGTGG - Intronic
901019909 1:6250275-6250297 GGTCACACAGCTTGTGTGGGTGG - Intronic
906673392 1:47676446-47676468 GGAAAGAGCCCTTTTGTGGGGGG - Intergenic
912547910 1:110464686-110464708 GGGAACACACATGGTTTGGGAGG - Intergenic
1063581727 10:7314209-7314231 GGGACAACCCCTTAAGTGGGAGG + Intronic
1065319283 10:24494160-24494182 GGGAACAGCCCTTTTGTGCAAGG + Intronic
1072793638 10:98337652-98337674 GGGAGCAGCCCTTGTGTCTGTGG + Intergenic
1074302168 10:112242532-112242554 GGGAAGACCCCTTCTGCGTGAGG - Intergenic
1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG + Intronic
1076191050 10:128483689-128483711 GGAAACACCCTGTGGGTGGGCGG + Intergenic
1079332032 11:19541583-19541605 GAGTACATCCCCTGTGTGGGAGG - Intronic
1080448844 11:32362187-32362209 GGCAACACCCCTGGTGGGAGGGG - Intergenic
1081201932 11:40227091-40227113 GAGAACACTCTTTGTGTGAGTGG - Intronic
1084030476 11:66477895-66477917 GGGAACATGCCTGGTGTGGAGGG + Intergenic
1084626686 11:70313040-70313062 GGGAACAACCGTGGTGTGGAGGG + Intronic
1085297102 11:75437494-75437516 GGGGAGACCCCTTGAGAGGGAGG + Intronic
1089797097 11:120989628-120989650 GTGAACACCCCATTGGTGGGAGG - Intergenic
1096648930 12:53052609-53052631 GGGAACCCCTCCTGGGTGGGAGG + Intronic
1096913904 12:55011793-55011815 GGGAAGAGCCCATGAGTGGGAGG + Intergenic
1097065261 12:56315956-56315978 CGGGACACCCCGTGTGTGGCAGG - Exonic
1100286060 12:93168017-93168039 GGTAAAACCCCTTTTGTGGCTGG - Intergenic
1102884190 12:116508975-116508997 GGGAACAGCCCAAGCGTGGGTGG - Intergenic
1103885248 12:124195571-124195593 GGGAATAACCAGTGTGTGGGGGG - Intronic
1113936215 13:113996368-113996390 GGGAGGACCCCTCGGGTGGGAGG + Intronic
1124376160 15:29130117-29130139 GCTCACACCCTTTGTGTGGGTGG - Intronic
1124490036 15:30150003-30150025 GGGAAGACGCCTGGGGTGGGTGG - Intergenic
1124753496 15:32388324-32388346 GGGAAGACGCCTGGGGTGGGTGG + Intergenic
1124975239 15:34524026-34524048 GGGAAGACGCCTGGGGTGGGTGG + Intergenic
1125483385 15:40095596-40095618 GGGAACTCCCATTCTGTGAGGGG - Intronic
1127218524 15:56851243-56851265 AGAAACACACCTTGTGTTGGTGG + Intronic
1128495125 15:68193655-68193677 GGGAATCCAGCTTGTGTGGGGGG + Exonic
1130928298 15:88401528-88401550 GTGAACACCCATTGTGTGCCAGG - Intergenic
1131344489 15:91633372-91633394 GGGCACAGCCCTGGAGTGGGTGG + Intergenic
1138101124 16:54253149-54253171 GGGAGCACCCCTAGTGTGGTGGG - Intronic
1138213207 16:55180345-55180367 GGGAACAGCCCATGAGAGGGAGG + Intergenic
1140240263 16:73193633-73193655 GGGGACAACCCCTGTCTGGGAGG + Intergenic
1143656320 17:8295689-8295711 GGGACCGCCCCTCGGGTGGGCGG + Intergenic
1143983323 17:10889748-10889770 GGGAACTACCCTAGTGTGGAGGG - Intergenic
1151202221 17:72476868-72476890 GCGAACAGACCTCGTGTGGGGGG + Intergenic
1152242868 17:79169349-79169371 GGGAACACCCCTGGGCTGTGCGG + Intronic
1153212376 18:2781142-2781164 GGGGACACCCCCTCTGTGGGGGG + Intronic
1154107276 18:11533785-11533807 GGAAACAGCACTTGGGTGGGAGG + Intergenic
1155241996 18:23872739-23872761 GGGAACACGCCCTGGGTAGGAGG - Intronic
1156993702 18:43440491-43440513 GGGAAAATCCCCTGTGTGGCTGG - Intergenic
1158426893 18:57348354-57348376 GGCAACACGCTTTGTCTGGGAGG - Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159060567 18:63510198-63510220 GGAAAGAACCCTGGTGTGGGAGG + Intergenic
1160716839 19:580567-580589 GGGAACAGCCCTCCTGCGGGAGG + Intronic
1164774763 19:30844309-30844331 GGGCAAGCCTCTTGTGTGGGGGG + Intergenic
1166265946 19:41684446-41684468 AGAAACACCCCTTGGCTGGGTGG - Intronic
1168327244 19:55544716-55544738 GGGAATGCCCCCTGTCTGGGTGG + Intronic
926634611 2:15166156-15166178 GGGAACACCCCTTGTGTGGGAGG + Intergenic
927528628 2:23772716-23772738 GGGAACACTGCTTTTTTGGGGGG + Intronic
928113149 2:28526317-28526339 GGGTCCTCCCCTTGGGTGGGAGG - Intronic
937764475 2:125643574-125643596 TGAAACACCCCTTAAGTGGGAGG - Intergenic
938714935 2:134010540-134010562 GTGGACTCCCTTTGTGTGGGTGG + Intergenic
941646283 2:168045239-168045261 GGAAACACCCAGGGTGTGGGAGG - Intronic
946228446 2:218277283-218277305 GGGAACATCCCTAGTGTGCCGGG + Intronic
946752644 2:222907788-222907810 GGGAACAGCCATTGTGTGGCAGG - Intronic
947005798 2:225509592-225509614 TTGAACACCCCTTGTGTAGTGGG - Intronic
948931911 2:241137434-241137456 GGAAAGAGCCCTTCTGTGGGTGG + Intronic
1172999951 20:39098530-39098552 GAGAACACCACGTGTGTGGGAGG - Intergenic
1174041769 20:47705267-47705289 GGAACCTCCCTTTGTGTGGGAGG + Intronic
1175483651 20:59329294-59329316 GGAAACCCCACTTGTGTGGCTGG - Intergenic
1176663265 21:9660311-9660333 GGGAGCACCCCTTGTCGGGGAGG - Intergenic
1179255313 21:39710832-39710854 AGGAACAGCCCCTGTGTGGGAGG + Intergenic
1179895283 21:44358375-44358397 GGGAGCCCCCCTTGGGTGGCAGG + Intronic
1180970303 22:19811690-19811712 GGGAACACCCAGGGGGTGGGGGG - Intronic
1181047142 22:20220510-20220532 GGGAACACCCAGTGTGTGCCAGG + Intergenic
1184668578 22:46001265-46001287 GTGACCACCCCGTGAGTGGGTGG - Intergenic
954543876 3:51416250-51416272 GGGAAAAGCCCTTGCTTGGGAGG - Intronic
955683932 3:61530883-61530905 GGGAAAAGTCCTTTTGTGGGTGG - Intergenic
958734318 3:97991073-97991095 GTGAACACACGTTGTGTGGCAGG + Intronic
969080660 4:4615410-4615432 GGGAAGGCCCCTCGTGTGGAAGG + Intergenic
969375823 4:6762558-6762580 GGAAGCTCGCCTTGTGTGGGTGG + Intergenic
976213429 4:82693643-82693665 TGGAACACCCCTGGGGTGAGAGG + Intronic
983427911 4:167610102-167610124 GTGAAGTCTCCTTGTGTGGGGGG + Intergenic
984928246 4:184825602-184825624 GGGACCGACCCTTGTGTGTGCGG - Intronic
985412062 4:189695739-189695761 GGGAGCGCCCCTTGTCGGGGAGG + Intergenic
985526842 5:408216-408238 GGTTGCACCCCTTGTATGGGTGG + Intronic
994447824 5:99900113-99900135 GGGAAAACCGTTTGTGTGGCGGG - Intergenic
997408709 5:133673379-133673401 GGGAACACCCCTGCCCTGGGAGG - Intergenic
1000342600 5:160289230-160289252 TGGAAACCCCCTTCTGTGGGGGG - Intronic
1000979195 5:167798542-167798564 AGGAAAGCCCCTTCTGTGGGTGG + Intronic
1005939035 6:30547125-30547147 CGGAACACCCCTGGTGTGCCTGG - Exonic
1006430148 6:33990450-33990472 GGCAGCCCCCCGTGTGTGGGAGG + Intergenic
1007286550 6:40751977-40751999 GGGAGCACCCCTAGTCTGAGGGG - Intergenic
1008084653 6:47231616-47231638 GTGGACTCCCTTTGTGTGGGTGG - Exonic
1013429049 6:110039834-110039856 GAGAAGACTCCTTGTATGGGTGG - Intergenic
1017671597 6:156774644-156774666 GGGAGCACCCTGTGGGTGGGAGG + Intergenic
1019390884 7:786620-786642 GGGAACACCCCTGGTAAGGAGGG + Intergenic
1019416781 7:931368-931390 GAGAACATGCCTTGTGTGGATGG - Intronic
1019610690 7:1935314-1935336 GGGAGCAGCCCTTGTGCAGGTGG + Intronic
1023081979 7:36534362-36534384 GGGAACATCCTTAGTGTGGGTGG + Intronic
1029473100 7:100766882-100766904 GGAAACACCACATCTGTGGGTGG + Intronic
1032631474 7:133657875-133657897 CTGAACACCCATTGTGTGGTTGG + Intronic
1034641609 7:152608380-152608402 GAGAACACCACGTGTGTGGGGGG + Intergenic
1037231885 8:16669024-16669046 GGGAACATACCTTGCTTGGGAGG + Intergenic
1041006033 8:53497626-53497648 AGGAACACACCTGGAGTGGGTGG + Intergenic
1041741826 8:61164703-61164725 GAGAAAACCTCGTGTGTGGGGGG - Intronic
1046966021 8:120166626-120166648 GGTGACAGCCCATGTGTGGGTGG + Intronic
1049537782 8:143189975-143189997 GGGCACACCCCTTCAGTGGGGGG + Intergenic
1049602681 8:143515196-143515218 GGGAACTGCCCATGTGTGGTCGG - Intronic
1052855285 9:33402958-33402980 GGGAACCCCCATTGTGAAGGGGG + Intergenic
1053003711 9:34591258-34591280 GAGAGGACACCTTGTGTGGGCGG - Intergenic
1057182602 9:93038043-93038065 GAGACCACCCCCTGGGTGGGGGG + Intergenic
1058001133 9:99866681-99866703 GTGAACATGCCTTCTGTGGGCGG + Exonic
1059208391 9:112487176-112487198 GGGGAGCCCCTTTGTGTGGGGGG + Exonic
1060406479 9:123375495-123375517 GGAAATACCTCTTGTGTGGGGGG - Intronic
1061511408 9:131063441-131063463 GGGAACCACCCTTGGGAGGGAGG + Intronic
1062204359 9:135327602-135327624 GGGATAAGCCCTTGGGTGGGCGG + Intergenic
1062431986 9:136530336-136530358 GGGGAAACCCTTTGTGTGGGAGG + Intronic
1203662834 Un_KI270753v1:61454-61476 GGGAGCACCCCTTGTCGGGGAGG + Intergenic
1203670532 Un_KI270755v1:7242-7264 GGGAGCGCCCCTTGTCGGGGAGG - Intergenic