ID: 926637027

View in Genome Browser
Species Human (GRCh38)
Location 2:15191875-15191897
Sequence CCTCAAAGGGACCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926637027_926637034 17 Left 926637027 2:15191875-15191897 CCAGCCTCAGGGTCCCTTTGAGG 0: 1
1: 1
2: 3
3: 28
4: 324
Right 926637034 2:15191915-15191937 ATCATGCACACTCCCATCTCAGG 0: 1
1: 0
2: 5
3: 28
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926637027 Original CRISPR CCTCAAAGGGACCCTGAGGC TGG (reversed) Intronic
900425289 1:2575640-2575662 CGTCATACGGACCCTGAAGCAGG + Intergenic
900487806 1:2931762-2931784 AAGCAAAGGGCCCCTGAGGCTGG + Intergenic
900573834 1:3373341-3373363 CCGCAAAGGCACGCTGGGGCGGG - Intronic
900671635 1:3858037-3858059 ACTCAAGGGGAAGCTGAGGCCGG - Intronic
902093975 1:13927286-13927308 TCACACAGGGACCCTGAAGCAGG + Intergenic
902955430 1:19921851-19921873 CCTCAATGGGACTGTCAGGCTGG - Intronic
902978884 1:20109219-20109241 CCTCAAGGGGACACTGAGATAGG + Intergenic
905075590 1:35268520-35268542 CCTTAAAGGGACCATGACGCAGG - Intergenic
907257154 1:53188434-53188456 CCTTAAAGGGACCCTGAGGCCGG + Intergenic
907393825 1:54176235-54176257 ACTCAAAGGGCCCTGGAGGCAGG + Intronic
908756580 1:67474286-67474308 GCTCCAAGGGAGGCTGAGGCAGG - Intergenic
909371166 1:74885051-74885073 ACACACAGGGACCCTGGGGCTGG - Intergenic
911584939 1:99679805-99679827 TCTCACAGGCAGCCTGAGGCAGG - Intronic
912004316 1:104878353-104878375 CAGCAGAGGGACCCTGAGCCTGG - Intergenic
914355480 1:146880919-146880941 CCACACAGGGAAACTGAGGCAGG + Intergenic
916492778 1:165316402-165316424 CCTCAAAGTGACCGTGGTGCTGG - Intronic
917683167 1:177388451-177388473 TATCAAAGGGACACTGAGGCTGG - Intergenic
920007431 1:202843708-202843730 CCTCAAGATGACCCTGAGGGAGG + Intergenic
920461296 1:206142576-206142598 CCTCCAAGGGATTCTGAGGCAGG - Intergenic
920915636 1:210255965-210255987 CCTCACAGGACCCCTGGGGCAGG + Intergenic
921847527 1:219899734-219899756 CCTCAAAACAACCCTGAGGTAGG - Intronic
922022333 1:221717335-221717357 CCTCACAGGGCCTCTTAGGCAGG + Intronic
922040026 1:221887374-221887396 CCAAAAAGGGAATCTGAGGCTGG + Intergenic
922241544 1:223758541-223758563 CCTCTAAGAGACTCTCAGGCAGG - Intronic
922587964 1:226750188-226750210 GCTACGAGGGACCCTGAGGCAGG - Intergenic
922915855 1:229257109-229257131 CCTCACAGGGATCCTGAGGCAGG + Intergenic
923505183 1:234599792-234599814 CCTGCAAGGGTCCCTGACGCGGG - Intergenic
924540415 1:244975569-244975591 CATCAAAGGAATGCTGAGGCCGG + Intronic
924857212 1:247885702-247885724 CCTCAAGAGGAGTCTGAGGCAGG - Intergenic
1064346497 10:14537330-14537352 CCTCATACGGCCCATGAGGCAGG + Intronic
1064500138 10:15962482-15962504 ACTCAAAGGGACACTGATGTTGG + Intergenic
1064593505 10:16919716-16919738 CCTGCAAGGGACACTGAGGGTGG - Intronic
1065226036 10:23544974-23544996 CATCACAGGGACCCTGGGCCCGG - Intergenic
1066470093 10:35689610-35689632 CTTCAAAGTGTTCCTGAGGCAGG + Intergenic
1067313305 10:45136000-45136022 CCTGCAAGGGACGCTGAGGGTGG + Intergenic
1068196165 10:53719593-53719615 CATCAAAGGGACCCCTAGGCAGG - Intergenic
1069201972 10:65630534-65630556 ACTGCAAGGGAGCCTGAGGCAGG + Intergenic
1069609342 10:69762281-69762303 CCTCACAGCAACTCTGAGGCAGG + Intergenic
1070617545 10:77980417-77980439 CCTCAATGGGACACAGAGGGCGG - Intronic
1072417940 10:95264331-95264353 CCTCTAAGGCACCCTCGGGCAGG + Intronic
1073401292 10:103259784-103259806 CATCAGAGGGACCCTGGGCCTGG - Intergenic
1074042924 10:109810118-109810140 CAGCACAGGGACCCTGAGCCTGG + Intergenic
1074445731 10:113519797-113519819 TCTCAAAGGGAGCCAGAGCCTGG - Intergenic
1075752203 10:124782248-124782270 GCACAAAGGGAGGCTGAGGCGGG + Intronic
1076700762 10:132271467-132271489 CCTCACTGGGCACCTGAGGCTGG + Intronic
1076907431 10:133370216-133370238 ACGCAGAGGGGCCCTGAGGCAGG + Intronic
1077362511 11:2146960-2146982 CCACAATGGGATCCTGACGCCGG + Intronic
1077463854 11:2724227-2724249 CCGCAAAGGGGTCCTGAGCCGGG - Intronic
1078364582 11:10695539-10695561 CTTCAAAAGGAAACTGAGGCTGG + Intergenic
1078528896 11:12121247-12121269 CCTCAAATTGACCTTGAGTCAGG - Intronic
1078706198 11:13746557-13746579 CCACAAATGGACCCTGTGTCAGG + Intergenic
1078748403 11:14137269-14137291 CCTAAGAGGGATTCTGAGGCTGG - Intronic
1079983844 11:27179572-27179594 CTCCAGAGGTACCCTGAGGCAGG - Intergenic
1081048526 11:38308082-38308104 ACTCAAAGGAAGCATGAGGCAGG - Intergenic
1081124365 11:39304684-39304706 CCTCAAAGAGACCTTGAGTAGGG - Intergenic
1081547696 11:44083426-44083448 CCTCAAAGGTGCCCTTGGGCAGG - Exonic
1081743565 11:45457597-45457619 ACTCAAATGGTCCCTGTGGCTGG - Intergenic
1081776430 11:45678852-45678874 CTTCCAATGGACCCTGAAGCCGG + Intergenic
1081778821 11:45695721-45695743 CATCACAGTGACTCTGAGGCAGG + Intergenic
1081923416 11:46801371-46801393 TCTCAAAAGAACTCTGAGGCCGG + Intronic
1081931027 11:46871566-46871588 CCTCAATGGGAAACTGCGGCAGG - Exonic
1085127397 11:74011138-74011160 ACACAAAAGGACCCTGAGGGTGG - Intergenic
1085519902 11:77131639-77131661 CCTCAGAGGCCCCCTGAGGGAGG - Intronic
1085519906 11:77131643-77131665 CCTCAGGGGGCCTCTGAGGCAGG + Intronic
1085755785 11:79200260-79200282 CTTCAGAAGGACCCAGAGGCAGG + Intronic
1088358367 11:108966577-108966599 GCTCAAGGTGGCCCTGAGGCAGG - Intergenic
1089195917 11:116693977-116693999 CCTCCAAGGGACCCACAGGCGGG + Intergenic
1090709592 11:129373470-129373492 CCGCGGCGGGACCCTGAGGCTGG - Intergenic
1090830918 11:130420374-130420396 CTTCAAGGGGTCGCTGAGGCAGG - Intronic
1090881030 11:130831497-130831519 CAGGAAAGGGACCCAGAGGCTGG + Intergenic
1092218965 12:6700298-6700320 CGGCGAAGGGACCCCGAGGCAGG + Exonic
1092271700 12:7029066-7029088 CCTCAATGGGGGGCTGAGGCAGG - Intronic
1093991343 12:25592601-25592623 CCTCACAGGGTCCTTGGGGCGGG + Intronic
1095269847 12:40204811-40204833 CCTCAGAGGTACCCTGTGGACGG + Intronic
1097136001 12:56856252-56856274 CCTCATAGGAACCATGAGTCAGG - Intergenic
1097460164 12:59851727-59851749 CCTCCTCGGGACGCTGAGGCAGG + Intergenic
1103342070 12:120226013-120226035 CCTCCATGGGACCCGGAGGGCGG - Intronic
1104905536 12:132211707-132211729 CGTCGAGGGGACCCTGGGGCAGG + Intronic
1105539808 13:21306629-21306651 ACTCACAAGGACCCTGAGGCAGG - Intergenic
1105798515 13:23881421-23881443 ACTCACAAGGACCCTGAGGCAGG + Intronic
1109842347 13:67935748-67935770 GTTCAAAGGGGCCCTAAGGCTGG - Intergenic
1112328513 13:98459723-98459745 CCTCAAAGGCAGCCTCAGCCAGG + Intronic
1112840174 13:103565573-103565595 TGTGAAAGGGACCCTGTGGCAGG - Intergenic
1112954729 13:105043414-105043436 CTTCACAGGGACCCTGATCCTGG + Intergenic
1113421644 13:110175715-110175737 CGTCACAGGGACTATGAGGCGGG + Intronic
1114191971 14:20446546-20446568 GCTCCAAGGGAGGCTGAGGCGGG - Intronic
1115633429 14:35267794-35267816 GCCCAAAGGAGCCCTGAGGCAGG + Intronic
1116974569 14:51101470-51101492 TCCCAAGGGGACCCTGAGGTAGG + Intergenic
1117137194 14:52747743-52747765 CCTCAATGGGAGGCTGAGGCAGG + Intronic
1118330317 14:64809830-64809852 CCTTAAAAGGCTCCTGAGGCAGG + Intronic
1121153706 14:91663397-91663419 GCTCAAACGGAGGCTGAGGCAGG + Intronic
1121850653 14:97218887-97218909 CCACAAAGGCAGCCTGAGCCAGG + Intergenic
1122061869 14:99141310-99141332 CCTCCAAGGAACCCTGAGAGGGG - Intergenic
1122844472 14:104484516-104484538 CCTCTTTGGGACGCTGAGGCAGG + Intronic
1122873104 14:104650525-104650547 CCCCAAACGGACACTGAAGCGGG + Intergenic
1123050274 14:105538058-105538080 CCTCAAAGGGACCCAGAGCCGGG - Intergenic
1123129101 14:105971736-105971758 CCTCAGAGGCATCATGAGGCTGG - Intergenic
1123672147 15:22669501-22669523 GCACAATGGGAGCCTGAGGCAGG - Intergenic
1124324196 15:28742712-28742734 GCACAATGGGAGCCTGAGGCAGG - Intergenic
1125473245 15:40024983-40025005 TCTCCAAGGGTCCCTCAGGCTGG + Intronic
1126609965 15:50519416-50519438 AATCAAAGCCACCCTGAGGCCGG + Intronic
1127333316 15:57959629-57959651 CCTCACAAGAACCCTGAGGTAGG + Intronic
1127460380 15:59193231-59193253 CCTCCTGGGGATCCTGAGGCAGG + Intronic
1128237940 15:66080183-66080205 CCTGAAAGAGACCATGAGACAGG - Intronic
1128297364 15:66535244-66535266 CCTCAAAAAGAGCCTCAGGCAGG - Intronic
1128702356 15:69813749-69813771 CCTCAAAGTTACCCAGAAGCAGG - Intergenic
1128828806 15:70747353-70747375 CCTAAAAGGGAGGCTGAGGCGGG - Intronic
1130270119 15:82441790-82441812 CCTCTGAGGGACCCTGGGGAAGG + Intergenic
1130485532 15:84396294-84396316 CCTCTGAGGGACCCTGGGGAAGG + Intergenic
1130490217 15:84425682-84425704 CCTCTGAGGGACCCTGGGGAAGG - Intergenic
1130518445 15:84644217-84644239 GCTGAAAGGGACCCAGAGGTAGG - Intronic
1130656140 15:85793452-85793474 CACCAAATGGACCCTGAGGTGGG + Intronic
1132846521 16:2003375-2003397 CCTCAAGGTGCCCCCGAGGCAGG + Intronic
1134274749 16:12766144-12766166 CCCCAAAGGGAGGCAGAGGCGGG + Intronic
1135413228 16:22250589-22250611 CCCAAAAGGGACCCTAAGACAGG - Intronic
1136235435 16:28910914-28910936 CCTGCAAGGGACCGTGAGCCAGG - Exonic
1137600794 16:49754861-49754883 CCTCAAAGGGCCCCCTGGGCAGG + Intronic
1139978539 16:70834524-70834546 CCACACAGGGAAACTGAGGCAGG - Intronic
1140905552 16:79406235-79406257 CCTGAAACAGACCCTGAGACAGG - Intergenic
1141041919 16:80679939-80679961 CCTCCAAGGGATTCTGACGCCGG + Intronic
1142499371 17:323780-323802 CCTCACAGTCACCCCGAGGCAGG + Intronic
1142964451 17:3572035-3572057 CCTCATGGAGGCCCTGAGGCAGG + Intronic
1143116263 17:4583483-4583505 CCTGAAAGAGGCCCAGAGGCTGG - Intergenic
1144055511 17:11537218-11537240 CTCCAAGGGGACCCTGAGTCAGG + Intronic
1145998223 17:29116533-29116555 CCTCGGAGGGACCGTGGGGCGGG + Intronic
1146654796 17:34628843-34628865 CCTCAGTGGGATCCTGGGGCTGG + Intronic
1146793512 17:35765975-35765997 CCACAAAGGGCCTCTGAGGTTGG + Intronic
1147131233 17:38410497-38410519 CCACAGAGTGACCCTGGGGCAGG - Intergenic
1147963834 17:44182518-44182540 CCTACAAGGGAGGCTGAGGCAGG + Intergenic
1151687839 17:75659726-75659748 CCTCACAGTGACCCTGAGTTAGG - Intronic
1151835368 17:76579434-76579456 CCTGACAGGGCCCCAGAGGCAGG + Intronic
1151880773 17:76893216-76893238 CCTCAAGGACACCCTGAGGGGGG - Intronic
1151898150 17:76994273-76994295 CCTCACAGGAAGCCTGAGGTCGG - Intergenic
1151955593 17:77378680-77378702 GCTCAGAGGGACCCCCAGGCGGG - Intronic
1151975788 17:77482931-77482953 CCTCACAGGGACCCTGTGAAGGG + Intronic
1152184626 17:78846760-78846782 CCTGAGAGGAACCCTGAGGAAGG - Intergenic
1152300481 17:79492599-79492621 CCTCGAAGGGACGCTGAGCCAGG + Intronic
1152560417 17:81075835-81075857 CCTCATATGGAGCCTGTGGCTGG - Intronic
1153382706 18:4455822-4455844 TCTCCTAGGGACCCTGAGGAGGG - Intergenic
1153942241 18:9988306-9988328 CATCAAAGCGACCCTGTTGCTGG - Intergenic
1154134503 18:11763899-11763921 CCTCAAAGGAACTCTGAGTGTGG - Intronic
1155445811 18:25912118-25912140 CCTACAAGGGAGGCTGAGGCAGG - Intergenic
1157599776 18:48886853-48886875 CCTGGCAGGGACACTGAGGCAGG - Intergenic
1160895286 19:1399524-1399546 CATCAAAGTGACCGTCAGGCAGG + Exonic
1161152932 19:2719156-2719178 CATAAATGGGATCCTGAGGCTGG + Intronic
1161327687 19:3671410-3671432 CCACAGAGGGAAACTGAGGCAGG - Intronic
1161349746 19:3785139-3785161 CCCCAGAGGGAAACTGAGGCAGG + Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1163694593 19:18757503-18757525 CCTCCAAGGGCTTCTGAGGCAGG - Intronic
1163717539 19:18880660-18880682 CCACATGGGGACACTGAGGCAGG - Intronic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164753056 19:30670222-30670244 TCTCAGAGGAAGCCTGAGGCTGG - Intronic
1165116775 19:33533439-33533461 GCTCCCAGAGACCCTGAGGCTGG + Intergenic
1165387629 19:35520243-35520265 CCTGTAAGGGAGGCTGAGGCAGG + Intergenic
1165454921 19:35904807-35904829 ACACGCAGGGACCCTGAGGCTGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1168132680 19:54331434-54331456 CCTGAAATGGAACCAGAGGCTGG + Intergenic
1168259760 19:55186747-55186769 TCTCAAAGGGACCCACAGCCGGG + Intronic
925811705 2:7707804-7707826 CCTCAAAGTTTCCCTGAGCCAGG + Intergenic
926421148 2:12700785-12700807 CCTCACATGGATCCTGAGGCAGG + Intergenic
926637027 2:15191875-15191897 CCTCAAAGGGACCCTGAGGCTGG - Intronic
927085856 2:19673409-19673431 GGTCAGAGGGGCCCTGAGGCCGG - Intergenic
927100285 2:19782927-19782949 CAGCAAAGGGACCCTGGGCCCGG - Intergenic
927318907 2:21720063-21720085 CCTCAAGGGCACCCTGAGGGGGG + Intergenic
927707210 2:25303788-25303810 CCGCAGAGGGAACCTCAGGCAGG - Intronic
927757156 2:25718172-25718194 CCTGTAAGGGAGGCTGAGGCAGG - Intergenic
928389394 2:30897606-30897628 CCACAAAAGGACCTGGAGGCGGG - Intergenic
929574142 2:43041704-43041726 CCTCAAATTAGCCCTGAGGCTGG + Intergenic
931267583 2:60674195-60674217 CTGCAAAGGGAGGCTGAGGCAGG + Intergenic
932396811 2:71454248-71454270 ACTCAGAGGGAAACTGAGGCTGG + Intronic
933172196 2:79136858-79136880 CCACAAAGGCACCCTCAGCCTGG + Intergenic
934473335 2:94575624-94575646 CCTCAAACTGACTCTGAGGGTGG + Intergenic
934473739 2:94578552-94578574 CCTCAAACTGACTCTGAGGGTGG + Intergenic
935110544 2:100090786-100090808 GCTCATCGGGATCCTGAGGCAGG - Intronic
936243344 2:110806690-110806712 CCTCAGAGGGCCCCTGAGTCAGG - Intronic
937907113 2:127057800-127057822 CCCGAGAGGGACACTGAGGCAGG + Intronic
939950099 2:148460579-148460601 CCTCAATGCCACCCTGAGGCAGG - Intronic
940771707 2:157845657-157845679 CCTGAAAGGGCCCCACAGGCAGG + Intronic
941094866 2:161227546-161227568 ACTCAAAGTAATCCTGAGGCAGG - Intronic
941510430 2:166401464-166401486 CCTCAAAGGAACACTTAGACTGG - Intergenic
941923740 2:170875719-170875741 GGTCAAACGGACCCTGAGGAGGG - Intergenic
942619913 2:177835305-177835327 TCTCAAATGCATCCTGAGGCAGG + Intronic
943769318 2:191697975-191697997 CCTCAAAAAGAGCCTCAGGCAGG - Intergenic
945466153 2:210171932-210171954 CCTCAGAGGGGCCCTGAAGTAGG + Intergenic
946121126 2:217515799-217515821 ACACACAGGGACCCTGAGTCTGG - Intronic
946412361 2:219521704-219521726 ACTCAGAGGCAGCCTGAGGCCGG - Intronic
946673625 2:222133305-222133327 ACTCAATGGGACACAGAGGCAGG - Intergenic
947022271 2:225693145-225693167 CCTGAAAGGGACTCTGGAGCAGG - Intergenic
947915251 2:233828442-233828464 CCCCACACAGACCCTGAGGCAGG + Intronic
948450696 2:238069349-238069371 CCTCAAAGGGACACACAGGTGGG + Exonic
948528664 2:238589159-238589181 ACACAAAAGGACCCTGGGGCAGG - Intergenic
1172484455 20:35290083-35290105 CTTCACAGGGAAACTGAGGCAGG - Intronic
1174553763 20:51379664-51379686 CCTGAGAGAGACCCTGAGCCTGG - Intergenic
1175255620 20:57645176-57645198 CAACAGAGGGACCCTGGGGCTGG - Intergenic
1175282475 20:57813313-57813335 CCTCAGAGGGGCGCAGAGGCTGG - Intergenic
1175371744 20:58497044-58497066 CCTCAAAGGGCCCCTGTCACTGG - Intronic
1175918627 20:62439516-62439538 GCCCACAGGCACCCTGAGGCTGG + Intergenic
1176286038 21:5020271-5020293 CCAGAAGGGGACACTGAGGCAGG - Intergenic
1176367569 21:6043159-6043181 CCGCAAAGGGAAGCTGGGGCGGG + Intergenic
1177555424 21:22681928-22681950 CATCACAGGGACCCTGGGCCTGG + Intergenic
1179603015 21:42493545-42493567 CCTCAAATGATCCCTGGGGCGGG + Intronic
1179755950 21:43495383-43495405 CCGCAAAGGGAAGCTGGGGCGGG - Intergenic
1179871143 21:44243204-44243226 CCAGAAGGGGACACTGAGGCAGG + Intergenic
1181180304 22:21063099-21063121 CCTACAAGGGACGCTGAGGCAGG + Intronic
1182445700 22:30387943-30387965 CCTCAGTGGGACCGAGAGGCTGG + Intronic
1182578844 22:31291657-31291679 CCTCAAAGGGACCCTAAGCCAGG - Intronic
1182815143 22:33155842-33155864 CAGCAAAGGGACCCTGGGCCTGG - Intergenic
1182878818 22:33715579-33715601 CCTCCAGAGGACCCTGATGCTGG - Intronic
1184777005 22:46628278-46628300 ACTCACAGGGTCCCTCAGGCGGG - Intronic
1185218577 22:49617383-49617405 CATCAAGGGGATGCTGAGGCTGG - Intronic
949218425 3:1600333-1600355 CCTCCAAGGGAGACTGAGTCAGG + Intergenic
949867562 3:8558982-8559004 CCTCTAGGGGATACTGAGGCAGG + Intronic
949914903 3:8952721-8952743 CCTCACAGCAACCCTGAGGTTGG + Intronic
949928043 3:9057584-9057606 CCTCACTGGGACCCAGAGGCTGG + Intronic
950088175 3:10276138-10276160 CCTCACAACCACCCTGAGGCAGG - Intronic
950240166 3:11362373-11362395 CCTCAAAGTGACCGTGAGATGGG - Intronic
950660391 3:14463576-14463598 CCACAAAGGGCCCCAGAGGTGGG + Intronic
952125052 3:30290663-30290685 CCTCAAACACACCCAGAGGCAGG + Intergenic
952541247 3:34370542-34370564 CAGCACAGGGACCCTGGGGCCGG - Intergenic
954439650 3:50514842-50514864 ACTGAAATGGACCCTGAGCCTGG - Intergenic
960745091 3:120878741-120878763 GCTCTTAGGGAGCCTGAGGCAGG - Intergenic
961088837 3:124092560-124092582 CCTAACAGGAACCCTGAGGGAGG - Intronic
962646743 3:137447845-137447867 CCTCAAAGGGCCTCTCCGGCTGG - Intergenic
963082214 3:141404440-141404462 CCTCACAGAGGCCCTGAAGCTGG - Intronic
963805292 3:149715533-149715555 CCTCTAAGGGAGACTGAGTCAGG - Intronic
963941580 3:151101331-151101353 CCTCACAGGTACCGTGAGGCTGG - Intronic
965897463 3:173594955-173594977 CAGCACAGGGACCCTGAGCCTGG + Intronic
967037657 3:185660038-185660060 CTTTAAAGGGAGGCTGAGGCGGG - Intronic
967945463 3:194800418-194800440 ACTCTCAGGGACCCTGAGGGTGG + Intergenic
968764042 4:2458958-2458980 CCTCAAGGGGTCCCTGACCCTGG - Intronic
969689240 4:8695061-8695083 CTGCAAAAGGGCCCTGAGGCTGG + Intergenic
973212401 4:47631245-47631267 CCTAACAGGGGCCCTGGGGCTGG - Intronic
976789305 4:88859650-88859672 CCTCAAAAGGGCCCTCATGCTGG - Intronic
983177832 4:164612112-164612134 CCTACTAGGGACGCTGAGGCAGG - Intergenic
983460738 4:168023097-168023119 CATCACAGGGACCCTGGGCCCGG + Intergenic
983669052 4:170215090-170215112 CAGCACAGGGACCCTGAGTCTGG - Intergenic
985666106 5:1182258-1182280 CCTCTTAGGGAGGCTGAGGCAGG - Intergenic
985963319 5:3320339-3320361 CCTCAAAGCCGCGCTGAGGCAGG + Intergenic
987368286 5:17170036-17170058 CTTCAAATGGACTCTTAGGCTGG + Intronic
987737615 5:21866894-21866916 CAGTAAAGGGACCCTGGGGCAGG - Intronic
992381348 5:76240736-76240758 CCCCAAATGGAGCCTGAGACAGG - Intronic
993901295 5:93585461-93585483 CCTCAAAGTGGGCATGAGGCGGG + Exonic
994548696 5:101204844-101204866 CAGCACAGGGACCCTGAGCCTGG - Intergenic
997234359 5:132264149-132264171 CCTCAGAGGGGGCCTGAGTCAGG + Intronic
998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG + Intronic
998213370 5:140218563-140218585 CCTCAAAGTGGCACTGAGGTTGG + Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002575892 5:180173402-180173424 CATGAAGGGGACCCTGAGGTGGG + Intronic
1002986357 6:2192786-2192808 CCTCCAAGGGAGACTGAGTCAGG - Intronic
1003584231 6:7372173-7372195 TCTCAAAGGAACCCTGGGGTTGG + Intronic
1005716786 6:28557083-28557105 CCCCAAAGGGACACTGAGGTTGG + Intergenic
1006132607 6:31878284-31878306 CCTCACAGAGACCCCTAGGCAGG + Intronic
1006439979 6:34047897-34047919 CTTCAAAAGGAGCCTGTGGCTGG - Intronic
1006741556 6:36312654-36312676 CCTCAAAAGGGCCCAGAGTCAGG - Intergenic
1006956966 6:37882426-37882448 CATCAAAGGGACCCTAGGCCTGG - Intronic
1007123468 6:39402759-39402781 CCTTACAGGTATCCTGAGGCTGG + Intronic
1008103289 6:47415895-47415917 GGGCAAAGGGACCCTGATGCTGG - Intergenic
1015051077 6:128840946-128840968 CCTTCAAGTGACCCTGATGCAGG - Intergenic
1016139744 6:140594196-140594218 CAGCACAGGGACCCTGAGCCTGG - Intergenic
1016254421 6:142087422-142087444 GCTTAAATGGACCCTGAGTCAGG + Intronic
1016869049 6:148798622-148798644 CCTCAAAAGGACACAGATGCTGG + Intronic
1017123234 6:151043826-151043848 CCTCAAACTGACTCTGAGGGTGG - Intronic
1017123652 6:151046828-151046850 CCTCAAACTGACTCTGAGGGTGG - Intronic
1017703122 6:157095107-157095129 CCTCCAAGTGATGCTGAGGCAGG - Intronic
1017759502 6:157556979-157557001 CCTCCAAGAGACACTGAGGGAGG + Intronic
1018255399 6:161913060-161913082 CCTCCCAGGGAGGCTGAGGCAGG + Intronic
1018344899 6:162890590-162890612 TCTCTAAGTGACCCTGAGGAGGG - Intronic
1022498877 7:30870302-30870324 CCTCAAAAGGGTCCTGAGGGGGG - Intronic
1022622578 7:32000082-32000104 CCTCACAGTGACCGTGAGGTAGG - Intronic
1024004666 7:45216697-45216719 CCTCAGAGGCCCACTGAGGCAGG - Intergenic
1026262909 7:68771193-68771215 CCTTAAAGGGAGGCTGAGGCAGG + Intergenic
1026770537 7:73194922-73194944 GCACAAAGGGAAACTGAGGCAGG - Intergenic
1027011403 7:74748311-74748333 GCACAAAGGGAAACTGAGGCAGG - Intronic
1027076637 7:75197731-75197753 GCACAAAGGGAAACTGAGGCAGG + Intergenic
1030197157 7:106863728-106863750 CCTCAGAGGGACCATGAGCTTGG - Intergenic
1032111298 7:129078187-129078209 GCTCATCGGGAGCCTGAGGCAGG - Intergenic
1032229200 7:130059734-130059756 CCTCCAGGAAACCCTGAGGCTGG - Intergenic
1033333377 7:140433306-140433328 CCTCACAGAGCCCCTGTGGCTGG + Intergenic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1033981569 7:147171177-147171199 CCTCAAATGGCTCCTGAGGAAGG - Intronic
1034101249 7:148452375-148452397 CTTCAAAGGGTCCCTGTGGATGG + Intergenic
1035385777 7:158471841-158471863 CCTGAGAGGGGCCCTGGGGCCGG - Intronic
1035430760 7:158818867-158818889 CCTCAAAGCTAACCAGAGGCCGG + Intronic
1035865337 8:3075937-3075959 GCTCCTAGGGACGCTGAGGCAGG + Intronic
1036382764 8:8248614-8248636 ACTCACAGGGAGGCTGAGGCAGG + Intergenic
1036739694 8:11348780-11348802 CCTCACAGCAACCCTGAAGCTGG - Intergenic
1037756554 8:21713790-21713812 CCTCCCAGGGATTCTGAGGCAGG + Intronic
1038571895 8:28669910-28669932 CTTTAAAGGGACTTTGAGGCCGG + Intronic
1038898253 8:31812257-31812279 CCTCCAAGGGACCCTCATACAGG - Intronic
1040025330 8:42776440-42776462 CTTCAGAGTGACCCTGATGCAGG + Intronic
1040110359 8:43564483-43564505 TTTCAAAGGGACATTGAGGCAGG - Intergenic
1040286729 8:46104222-46104244 ACTCAGAGGGACGTTGAGGCAGG - Intergenic
1040299275 8:46179610-46179632 ACTCAAGGGGACTTTGAGGCAGG - Intergenic
1040302857 8:46196947-46196969 ACTCAAAGGGACGTTGAGGCAGG + Intergenic
1040303501 8:46200284-46200306 ACTCAAAGGGACATTGAGACCGG + Intergenic
1040304326 8:46204165-46204187 ACTCAAAGGGAGGTTGAGGCAGG + Intergenic
1040305401 8:46209303-46209325 ACTCAGAGGGACGTTGAGGCAGG + Intergenic
1040310366 8:46233759-46233781 ACTCAGAGGGACATTGAGGCAGG + Intergenic
1040311755 8:46240421-46240443 ACTCAGAGGGACATTGAGGCAGG + Intergenic
1040311845 8:46240854-46240876 ACTCAGAGGGACACTGAGGCAGG + Intergenic
1040314585 8:46254293-46254315 ACTCAGGGGGACACTGAGGCGGG + Intergenic
1040317716 8:46273721-46273743 CCTCAGGGGGACATTGAGGCAGG + Intergenic
1040319829 8:46286911-46286933 CCTCAGAGGGACATTGAGGCAGG - Intergenic
1040325355 8:46338816-46338838 CCTCAGTGGGACACTGAGGCAGG + Intergenic
1040331232 8:46386804-46386826 ACTCAGGGGGACACTGAGGCAGG + Intergenic
1040331379 8:46387454-46387476 ACTCATTGGGACCTTGAGGCAGG + Intergenic
1040331796 8:46389401-46389423 ACTCACAAGGACCTTGAGGCAGG + Intergenic
1040335807 8:46415361-46415383 ACTCAAGGGGACGTTGAGGCAGG + Intergenic
1040336858 8:46420475-46420497 CCTCAAGTGGACGCTGAGGCAGG + Intergenic
1040338003 8:46425923-46425945 ACTCAGAGGGACATTGAGGCAGG + Intergenic
1042033254 8:64501000-64501022 CCTCAATGGGATCCACAGGCTGG - Intergenic
1042772984 8:72399073-72399095 CAGCAAAGGGACCCTGATCCTGG + Intergenic
1047358691 8:124147354-124147376 TCTCATAGGGACCCAGAGCCCGG - Intergenic
1049007074 8:139862518-139862540 CTTCAAAGGGGCCCAGAGGCGGG + Intronic
1049449892 8:142654974-142654996 CCTCAAAGCCACCTTGGGGCAGG - Intergenic
1049519270 8:143079995-143080017 CCTCCAGGGGCCCCTCAGGCTGG - Intergenic
1049679791 8:143913052-143913074 CCTCAGAGGGTCCCTGTGACTGG + Intergenic
1050723042 9:8612719-8612741 CTTCTGGGGGACCCTGAGGCTGG + Intronic
1051642324 9:19235074-19235096 GCTACTAGGGACCCTGAGGCAGG - Intronic
1053252775 9:36588673-36588695 ATAAAAAGGGACCCTGAGGCAGG - Intronic
1053684591 9:40509960-40509982 CCTCAAACTGACTCTGAGGGTGG - Intergenic
1053685001 9:40512886-40512908 CCTCAAACTGACTCTGAGGGTGG - Intergenic
1053934559 9:43138238-43138260 CCTCAAACTGACTCTGAGGGTGG - Intergenic
1053934963 9:43141179-43141201 CCTCAAACTGACACTGAGGGTGG - Intergenic
1054278728 9:63112070-63112092 CCTCAAACTGACTCTGAGGGTGG + Intergenic
1054279134 9:63115005-63115027 CCTCAAACTGACTCTGAGGGTGG + Intergenic
1054297688 9:63345422-63345444 CCTCAAACTGACTCTGAGGGTGG - Intergenic
1054298092 9:63348350-63348372 CCTCAAACTGACTCTGAGGGTGG - Intergenic
1054395702 9:64649933-64649955 CCTCAAACTGACTCTGAGGGTGG - Intergenic
1054396110 9:64652867-64652889 CCTCAAACTGACTCTGAGGGTGG - Intergenic
1054430753 9:65158062-65158084 CCTCAAACTGACTCTGAGGGTGG - Intergenic
1054499628 9:65863459-65863481 CCTCAAACTGACTCTGAGGGTGG + Intergenic
1054500034 9:65866393-65866415 CCTCAAACTGACTCTGAGGGTGG + Intergenic
1054961083 9:70970330-70970352 CTTTAAAGGGACTCTGATGCAGG - Intronic
1056685873 9:88758815-88758837 CCTCCAAAGGACACTGATGCTGG + Intergenic
1057190922 9:93087232-93087254 GCACACAGGGACACTGAGGCAGG + Intergenic
1057214924 9:93222562-93222584 CAGAAAAGGGACCCTGACGCCGG - Intronic
1059308283 9:113371580-113371602 TCTCAAAGGGATGCTGAGGCAGG + Intergenic
1061127427 9:128685733-128685755 CTTCAAAGGGAGCCGGGGGCCGG + Intronic
1061378043 9:130237603-130237625 CCTACATGGGAGCCTGAGGCAGG + Intergenic
1061422527 9:130480025-130480047 CCTCCAAGGGATCATTAGGCCGG + Intronic
1061502576 9:131012517-131012539 CCTCAAAGACATCCTGACGCTGG + Intronic
1061898956 9:133663175-133663197 GCTCAAGGGGAAACTGAGGCAGG + Intergenic
1062005862 9:134238103-134238125 CCCCAAAGGGAAACTGAGGCTGG - Intergenic
1062017435 9:134297831-134297853 CCTCATGGGGAGGCTGAGGCTGG + Intergenic
1062489871 9:136799889-136799911 CCCCACAGGGAACCTGGGGCTGG - Intronic
1186124165 X:6394903-6394925 TCTCAAAGGAACTCTGAGACAGG + Intergenic
1187331229 X:18341473-18341495 ACCCATAGGGACCCTCAGGCTGG - Intronic
1190365987 X:49695504-49695526 CCTGAATGGGGCCCCGAGGCGGG - Intronic
1192171904 X:68860903-68860925 CCTGCCAGGGACCCTGATGCAGG - Intergenic
1195271163 X:103232434-103232456 CTTACAAGGGACCTTGAGGCAGG + Intergenic
1197518570 X:127469124-127469146 CTTCAAAGGGACGGTGAAGCAGG - Intergenic
1198740147 X:139833576-139833598 CCTACTAGGGAACCTGAGGCAGG + Intronic
1199301374 X:146218196-146218218 CCTCAACAGGAGGCTGAGGCAGG - Intergenic
1201605541 Y:15780324-15780346 TCTCAAAGGAACTCTGAGACAGG + Intergenic
1202376836 Y:24246019-24246041 CCTCTGAGGGACCCTGGGGAAGG - Intergenic
1202493944 Y:25424102-25424124 CCTCTGAGGGACCCTGGGGAAGG + Intergenic