ID: 926641921

View in Genome Browser
Species Human (GRCh38)
Location 2:15246216-15246238
Sequence CACAGGCAAAGGCCTAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926641921_926641928 13 Left 926641921 2:15246216-15246238 CCTTTCTTAGGCCTTTGCCTGTG 0: 1
1: 0
2: 0
3: 19
4: 343
Right 926641928 2:15246252-15246274 TGCAGGGGTTCACTCCTCTGAGG 0: 1
1: 0
2: 2
3: 9
4: 146
926641921_926641927 -2 Left 926641921 2:15246216-15246238 CCTTTCTTAGGCCTTTGCCTGTG 0: 1
1: 0
2: 0
3: 19
4: 343
Right 926641927 2:15246237-15246259 TGTTTCTGGAATCAGTGCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 248
926641921_926641925 -4 Left 926641921 2:15246216-15246238 CCTTTCTTAGGCCTTTGCCTGTG 0: 1
1: 0
2: 0
3: 19
4: 343
Right 926641925 2:15246235-15246257 TGTGTTTCTGGAATCAGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 270
926641921_926641926 -3 Left 926641921 2:15246216-15246238 CCTTTCTTAGGCCTTTGCCTGTG 0: 1
1: 0
2: 0
3: 19
4: 343
Right 926641926 2:15246236-15246258 GTGTTTCTGGAATCAGTGCAGGG 0: 1
1: 0
2: 1
3: 22
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926641921 Original CRISPR CACAGGCAAAGGCCTAAGAA AGG (reversed) Intronic
903023989 1:20413897-20413919 CTCAGGCTAAGGCCAGAGAAGGG + Intergenic
903382127 1:22904704-22904726 CACAGGCAAAGGAATGAGCATGG + Intronic
905993150 1:42357558-42357580 CACATTCGAAGGCCTATGAATGG + Intergenic
909552044 1:76908634-76908656 CACAGGCAAAGGTCTAACCTAGG - Intronic
911070931 1:93831308-93831330 CACAGGCTAAGGGAGAAGAAGGG - Intronic
911563056 1:99430116-99430138 CAGAGGCAAAAGTCAAAGAAAGG + Intergenic
912589661 1:110803652-110803674 CAAAGGGAAAGGACTAAGAGAGG + Intergenic
912813423 1:112810685-112810707 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
914963566 1:152229631-152229653 AACAGGCAAAGAGCTAAGGATGG - Intergenic
915742013 1:158125906-158125928 CACCGGCCAAGGCCTGTGAAGGG - Intergenic
915765149 1:158354983-158355005 CTCAGGCAAAGGATAAAGAAGGG - Intronic
916972674 1:170041540-170041562 CACAGGCAGATGCCTACGAGGGG - Intronic
917469371 1:175313630-175313652 CACAGGGCAAGGGCTAGGAAAGG + Intergenic
921108479 1:212008947-212008969 CATGGGGAAAGGCCTAAGCAGGG - Intronic
921771628 1:219047506-219047528 CACAGGTAAAGTGCTTAGAATGG - Intergenic
921772004 1:219051311-219051333 CACAAGTAAAGTCCTTAGAACGG + Intergenic
922526005 1:226304683-226304705 AACAGGTTAAGTCCTAAGAAGGG + Intronic
923214338 1:231834654-231834676 CACAGGCTAAGGGAGAAGAAGGG + Intronic
924637818 1:245805332-245805354 CACAAGCCAAGACCTAAGACTGG + Intronic
1066103508 10:32137882-32137904 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1066675523 10:37883116-37883138 CTCAGGCAATAGCATAAGAATGG - Intergenic
1067239394 10:44477420-44477442 GACAGCCAAAGGCCCAGGAATGG - Intergenic
1067345435 10:45434831-45434853 CACATGCAAAGACCTATGAAAGG + Intronic
1067772978 10:49140427-49140449 CACAGGAAAATTCCCAAGAAAGG + Intergenic
1068336454 10:55638707-55638729 AACAGGCAAAGGACCAAGAGTGG - Intergenic
1069993778 10:72330359-72330381 CACAGTCAAAGACCCTAGAAGGG - Intergenic
1070268331 10:74926570-74926592 CAGAGGCATGGGCCCAAGAAAGG - Intronic
1071662172 10:87515596-87515618 CACAGTGAAAGTCCTAAGCAGGG - Intronic
1071759288 10:88582866-88582888 CCCGGGAAAAGGCCCAAGAAGGG - Intronic
1073649497 10:105343538-105343560 CACAGGCACAGGCATATCAATGG + Intergenic
1074097060 10:110323124-110323146 CTGAGGCAAAGGCCCAAGGAGGG + Intergenic
1074582132 10:114729732-114729754 CACAGGCAAAACCATTAGAAAGG - Intergenic
1074937620 10:118201091-118201113 CAATAGCCAAGGCCTAAGAAGGG - Intergenic
1075086876 10:119419595-119419617 CAAGGGCAAAGCCCTAACAAGGG - Intronic
1075261612 10:120968111-120968133 CACAGTCACAGGCCAATGAATGG - Intergenic
1075906325 10:126084804-126084826 CCCAGTGAAAGGCCAAAGAATGG + Intronic
1076200948 10:128557401-128557423 CACAGGCAATGTCTTCAGAAAGG + Intergenic
1078962859 11:16299786-16299808 CACCAGGAAAGGCCAAAGAAAGG + Intronic
1079454262 11:20623475-20623497 AGCAGGCAAAGGACAAAGAATGG - Intronic
1081287575 11:41289836-41289858 GACAGGCAAATGCATAAAAATGG + Intronic
1082096423 11:48134430-48134452 CACAGACAAAAGCCCATGAAAGG - Intronic
1082220670 11:49632033-49632055 CATAGGCTAAGGCAGAAGAATGG - Intergenic
1082962074 11:58927923-58927945 CACACGGAAAAGCCTAAAAAGGG - Intronic
1083459095 11:62799058-62799080 GAGAGGCAAAGGAATAAGAAAGG + Intronic
1083769091 11:64856436-64856458 AACAGGCACATGCCTAAGCAAGG - Intronic
1084107152 11:66987581-66987603 CACAGGCACAGGCAGAAGCAGGG - Intergenic
1084793849 11:71491326-71491348 CCTCGGCAAAGGCCGAAGAAAGG - Intronic
1085060629 11:73443136-73443158 CACTGGGAAAGGGCTAAGAAAGG - Intronic
1085570042 11:77551180-77551202 CACAGGCTAAGGGAGAAGAAGGG - Intronic
1085987884 11:81807482-81807504 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1086136414 11:83447348-83447370 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1088156459 11:106810293-106810315 AGCAGGCAAAGGCCCAAGATGGG - Exonic
1088544770 11:110948168-110948190 CATAAGCAAAGGCCGCAGAATGG + Intergenic
1088553072 11:111034238-111034260 CACAGGCAAAGACGTCAGCAGGG + Intergenic
1089730301 11:120514874-120514896 AACAGCCAAAGGCCCAAGTAGGG - Intronic
1090194380 11:124802153-124802175 TACAGGTAAAGTCCTTAGAACGG + Intergenic
1091470409 12:721371-721393 CAAAGGCAAAGGCATTACAATGG - Intergenic
1091775983 12:3185271-3185293 CAAAAGCACAGGCCAAAGAAAGG - Intronic
1092193041 12:6533980-6534002 CTCAGGCAAAGGCCTAGGAGGGG - Exonic
1092416314 12:8292982-8293004 CACAGGCTAAGGGAGAAGAAAGG + Intergenic
1092592889 12:9967512-9967534 CACAGGCTAAGGGAGAAGAAGGG + Intronic
1093302085 12:17470848-17470870 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1093322124 12:17724719-17724741 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1093683101 12:22025064-22025086 CAAACACAAAGGCCTGAGAATGG - Intergenic
1093950929 12:25164423-25164445 CACAGGCTAAGGGAGAAGAAGGG - Intronic
1094092641 12:26668325-26668347 CACAGCCAAAGCCCAAATAAGGG - Intronic
1094539344 12:31350222-31350244 GACAGGCAAAGGCCTGAGTAAGG - Intergenic
1095995128 12:48075943-48075965 CACATGCAAAGCCCTGAGAGAGG + Intronic
1099156887 12:79188579-79188601 CACAGGCAAAGCCATAAATAAGG + Intronic
1099732143 12:86518672-86518694 CATATGGAAAGGCCTAGGAATGG - Intronic
1101580215 12:106036199-106036221 CACAGGCCAAGGCCTGATATGGG + Intergenic
1105503719 13:20992589-20992611 AACAGGCAAAGGCCACAAAAAGG + Intronic
1106748529 13:32731137-32731159 AACATGTAAAGGCCTAAAAATGG - Intronic
1107374563 13:39788096-39788118 CACAGGAAAAGCTCTAAGCATGG - Intronic
1107454189 13:40538947-40538969 CAAAGGCAAATGGCTAATAATGG + Intergenic
1108225987 13:48289626-48289648 CACATACAAAAGACTAAGAAAGG - Intergenic
1108354068 13:49614451-49614473 AAAAGGCAAAGGTGTAAGAAAGG + Intergenic
1108676493 13:52741370-52741392 CACAGAGAAAGGCCTTGGAAGGG + Intergenic
1113870627 13:113557688-113557710 CACAGGCAAATGCCTGACTAGGG - Intergenic
1113940775 13:114017629-114017651 CACAGGCAGAGGCCGCAGAGGGG - Intronic
1114221532 14:20701816-20701838 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1114771179 14:25429955-25429977 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1118114002 14:62753556-62753578 CACAGGCCAAGGGTAAAGAAAGG + Intronic
1118769512 14:68932702-68932724 CACACGCCAAGGTCTAAGCAAGG + Intronic
1119044036 14:71301712-71301734 CACAGGCAATGGGTTATGAAAGG + Intergenic
1120539704 14:85737417-85737439 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1121081099 14:91109020-91109042 GACAGGCAAAGACCCATGAAAGG - Intronic
1122376135 14:101259787-101259809 CTCAGGCAAATACCTAAGAGTGG + Intergenic
1123883256 15:24695702-24695724 CACAGGCCAAGCCATGAGAAGGG + Intergenic
1123890724 15:24775789-24775811 CACAGGCCAGGGCATGAGAAAGG + Intergenic
1123898442 15:24851484-24851506 CACAGGCCAGGGCATGAGAAGGG + Intronic
1125609615 15:40961414-40961436 CACAGGCAGAGGCCTAGCAAGGG - Intergenic
1126474557 15:49052062-49052084 GACAAGCAAAGGCCTCAGGAGGG + Intergenic
1127027684 15:54825305-54825327 CATATGCACAGGCCCAAGAATGG + Intergenic
1127289544 15:57557759-57557781 CAAGCCCAAAGGCCTAAGAATGG - Intergenic
1128537472 15:68501730-68501752 CACAGGCAAAGAGGTAAGTAAGG - Intergenic
1128741194 15:70084874-70084896 CACATGGAAAGGCCGAAGCAAGG - Intronic
1129089437 15:73133350-73133372 AAGATGCAAAGGCATAAGAATGG + Intronic
1131143778 15:89999283-89999305 CAAAGCCAAAGGCCAAAGCAAGG + Intergenic
1131447593 15:92512784-92512806 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1132262871 15:100441552-100441574 CACAGGCTAAGGGAGAAGAAGGG - Intronic
1133765870 16:8837432-8837454 CACAGGCTAAGGGAGAAGAAAGG + Intronic
1134662249 16:15992904-15992926 CACAGGCAAAGGCCACAGTGGGG - Intronic
1135025553 16:18996616-18996638 CACAGGCTAAGGGAGAAGAAGGG + Intronic
1135836558 16:25831052-25831074 CAGAGGCAAAGGCCTGAAGAAGG - Intronic
1137318983 16:47359077-47359099 CAAGGGCAAAGGCCTCAGGAGGG + Intronic
1137745433 16:50817035-50817057 ACCAGGCAAAGGCTTCAGAAAGG - Intergenic
1137939555 16:52670228-52670250 CACAGGCAAAGAAATTAGAAGGG + Intergenic
1138187540 16:54987833-54987855 CACAGGCAGAGAGCTAGGAATGG - Intergenic
1138834213 16:60413504-60413526 CATAGGTAAAGCCCTCAGAATGG + Intergenic
1139378796 16:66517278-66517300 CACAGGCAAAGGCGGGAGGAAGG + Intronic
1139382509 16:66542461-66542483 CACAGGCCAAGCCCTGAGACAGG + Intronic
1139595448 16:67955123-67955145 CAAAGGCACAGGCCTCAGGAGGG - Intronic
1140122596 16:72096476-72096498 GACAGGTAAAGGCCTTAGTATGG + Exonic
1141813911 16:86396467-86396489 CACAGGCAAAGGCCAACTGAAGG + Intergenic
1142504832 17:356753-356775 CACTGGCACAGGCCTCCGAAGGG - Intronic
1143128878 17:4663568-4663590 CAGTGACAAAGTCCTAAGAATGG + Intergenic
1148189045 17:45666222-45666244 CATGGGCAATGGCCAAAGAAAGG + Intergenic
1148810197 17:50285402-50285424 CATATGCAAAGGCCTGAGGAGGG + Intergenic
1149319372 17:55468745-55468767 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1149969634 17:61203896-61203918 CAGAGGCAAAGGGCAGAGAATGG + Intronic
1150032401 17:61753354-61753376 CACTGGCAAAGGACCAAGACTGG + Intronic
1151011546 17:70503818-70503840 TACATGCAAAGTACTAAGAAGGG - Intergenic
1151304069 17:73251707-73251729 TACAGGCGAGGGGCTAAGAATGG - Intronic
1153329375 18:3857662-3857684 CATAGGAAAAGCACTAAGAAAGG - Intronic
1153581165 18:6575145-6575167 CAGAGGCACTGGCCTAGGAAAGG - Intronic
1154979879 18:21494290-21494312 AACAAGTAAAAGCCTAAGAATGG + Intronic
1156378547 18:36536120-36536142 CACAGCCAGAGAGCTAAGAATGG - Intronic
1156445940 18:37236819-37236841 CAAAGAAAAAGGCCTAACAATGG + Intergenic
1157207046 18:45709720-45709742 CACAGGCAACGGCCTGGGATGGG + Intergenic
1158508681 18:58070079-58070101 CAAAGACAAAGCCCTCAGAAAGG - Intronic
1159141680 18:64403477-64403499 CAGAGGCAAAGGCTAAATAAAGG + Intergenic
1159871742 18:73766574-73766596 CACAGGCATGGGTCTAAGACAGG - Intergenic
1159972752 18:74674195-74674217 GGCAGGCAAAGGCCTGAGAAAGG - Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1164080658 19:21859032-21859054 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1164258620 19:23550513-23550535 CACAGGCTAAGGGAGAAGAAGGG - Intronic
1164770027 19:30801495-30801517 CCAAGGCACAGGCCCAAGAAGGG - Intergenic
1165069057 19:33245033-33245055 CAGAGGCCAAGGCCTAAGCAAGG + Intergenic
1166833057 19:45649692-45649714 CACTTTCAAAGGCCAAAGAAGGG + Intergenic
1167504358 19:49863237-49863259 CAGAGGAAAAGGCCTAAGGCAGG - Intronic
925119930 2:1410429-1410451 CACAGGCAAGGGCCTATTACAGG + Intronic
925433992 2:3820339-3820361 CACAGGCTAAGGGAGAAGAAGGG + Intronic
925926292 2:8673210-8673232 CACATGGAAAGGGCTAAAAAAGG - Intergenic
926641921 2:15246216-15246238 CACAGGCAAAGGCCTAAGAAAGG - Intronic
927571821 2:24166865-24166887 CCCAGGCAAAAGCCTGAGATGGG + Intronic
928770033 2:34695120-34695142 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
929049617 2:37825033-37825055 CCCAGGCACTGGCCTAGGAATGG + Intergenic
929428618 2:41868879-41868901 GACTGACAAAGGCCTAAGAGAGG + Intergenic
929674745 2:43915381-43915403 CAAAGGAAAATGCCTCAGAATGG + Intronic
929998680 2:46846638-46846660 AACAGGCAAAGGGCTGTGAACGG - Intronic
931341238 2:61402700-61402722 CAAAATCAAAGGCTTAAGAAAGG + Intronic
933137796 2:78759146-78759168 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
935095718 2:99942564-99942586 CACAGGGAATGGCCTGTGAAGGG + Intronic
935985131 2:108665152-108665174 CACAGGGAAATGTCTGAGAAAGG + Intronic
936137567 2:109908796-109908818 CACAGGGAAATGTCTGAGAAAGG + Intergenic
936207130 2:110462689-110462711 CACAGGGAAATGTCTGAGAAAGG - Intronic
936475414 2:112835500-112835522 CACAGGGAAAGCTCAAAGAAGGG - Intronic
936870649 2:117131567-117131589 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
938079668 2:128362994-128363016 TGCAGGCAGAGGCCTGAGAAGGG + Intergenic
938250518 2:129812432-129812454 CAGAGGCAAAGGCCTCAGGTGGG - Intergenic
939209207 2:139150693-139150715 CAAGGTCAAAGGCCTGAGAATGG + Intergenic
942096945 2:172543008-172543030 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
944286588 2:197957035-197957057 CACAAGCAAATGCCTATGAAGGG - Intronic
944407713 2:199404036-199404058 CACATGCAGATGCCAAAGAAGGG + Intronic
944408798 2:199416014-199416036 CAAAGGCATAGGCCTCAGCAGGG + Intronic
947275612 2:228388389-228388411 CACAAACAAAGACTTAAGAATGG - Intergenic
947344755 2:229179218-229179240 CACAAGCAGAGGCCAAAGAATGG + Intronic
947995849 2:234526449-234526471 CAAATGAAAAGGCCCAAGAAAGG - Intergenic
1168839126 20:897792-897814 CACAGGCTAAGGGAGAAGAAGGG - Intronic
1169587207 20:7098283-7098305 CACAGGCCATGGACAAAGAAAGG + Intergenic
1170680585 20:18522066-18522088 CACAGGCTAAGGGAGAAGAAGGG + Intronic
1171395462 20:24830048-24830070 CACAGGCTAAGTCTTAAGGATGG - Intergenic
1172288612 20:33758879-33758901 CACAGGCTAGGGGCTGAGAAGGG - Intronic
1173036894 20:39420468-39420490 CACAGTCAAAGGCCAATGAATGG + Intergenic
1173088680 20:39949872-39949894 CACTGGCAAAGGCATAAAACTGG - Intergenic
1174203584 20:48823976-48823998 CACATGCAAAGTGCTTAGAATGG + Intronic
1174275065 20:49397706-49397728 CACAGGCCTAGGCCCAAGACAGG - Intronic
1174331552 20:49823392-49823414 CAGAAGCAAAAGGCTAAGAAAGG - Intronic
1174461240 20:50684479-50684501 CACAGGCAAAGTCCTCATCACGG - Intronic
1175054479 20:56185713-56185735 CACAGGCAATGACCAAACAAAGG + Intergenic
1175593076 20:60208982-60209004 CACAGGCAAAGGTCCGGGAAGGG + Intergenic
1175643364 20:60649791-60649813 CAAAGGCAAAGGCCTTGGAAAGG - Intergenic
1177029609 21:15966612-15966634 CTCATGCAAGGGCCTAAGAAGGG - Intergenic
1178404241 21:32311543-32311565 CACAGGCAAATTCCTGAGAAGGG - Exonic
1179776776 21:43669362-43669384 GAAAGTCAAAGGCCTAGGAAAGG - Intronic
1180235698 21:46458411-46458433 CACAGGTAAAGGCACGAGAAAGG + Intergenic
1180831613 22:18909792-18909814 CTCAGGCAAAGGCATGGGAAAGG - Intronic
1181068242 22:20316597-20316619 CTCAGGCAAAGGCATGGGAAAGG + Intronic
1181832080 22:25568223-25568245 CACAAGCAAAGGCCCACAAAGGG + Intronic
1184314541 22:43674509-43674531 CACAGGCCAAGGCCTGGGAGGGG + Intronic
1184606762 22:45578840-45578862 CACAGGTAGAGGCTCAAGAAGGG - Intronic
1185059840 22:48600528-48600550 CACACGCAAAGTCCTAGGCATGG - Intronic
1203281695 22_KI270734v1_random:135063-135085 CTCAGGCAAAGGCATGGGAAAGG - Intergenic
950648510 3:14392681-14392703 CACAGGCCAGGGCCTCAGATGGG + Intergenic
953086671 3:39675290-39675312 ATGATGCAAAGGCCTAAGAATGG - Intergenic
953841339 3:46392379-46392401 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
953969124 3:47333344-47333366 CACTGCCAAAGGTCTAAGCAGGG + Intronic
954430263 3:50467079-50467101 GACACCCAAAGGCCTGAGAAAGG + Intronic
956072662 3:65470994-65471016 CACTGGCAAAGATCAAAGAATGG + Intronic
957060037 3:75474471-75474493 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
957310387 3:78511172-78511194 CACGGGCAAATGCCCATGAAGGG + Intergenic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
957394268 3:79619339-79619361 CACAGGCTAAGGGAGAAGAAGGG - Intronic
959353200 3:105294804-105294826 CAGAGCCAAAGGCCAGAGAAAGG + Intergenic
959543847 3:107571105-107571127 CACAGGCTAAGGGAGAAGAAGGG + Intronic
959569510 3:107867979-107868001 CCCAGGCAAAGCCCTAGGCAGGG + Intergenic
960378428 3:116931125-116931147 CACTGACAAAGGGCAAAGAAAGG + Intronic
962902919 3:139776498-139776520 CACAGCCAATGGCCTAAGCCAGG - Intergenic
963058475 3:141206235-141206257 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
964212631 3:154245468-154245490 CACAGGCAAAGGAACAAAAAAGG - Intronic
964300390 3:155279624-155279646 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
964809975 3:160652896-160652918 CACAGACAATAGACTAAGAATGG - Intergenic
965132371 3:164717523-164717545 CACAGGGAAAGGCATTTGAAAGG + Intergenic
966398589 3:179525372-179525394 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
966905291 3:184519666-184519688 CACAGGCTGAGGCAGAAGAATGG + Intronic
969003951 4:4004655-4004677 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
969235515 4:5862629-5862651 CTCAGGCAAAGGCCTGGGCACGG + Intronic
969373385 4:6747974-6747996 CAGAGAAAAAGGCCTAGGAAGGG + Intergenic
969748917 4:9095528-9095550 CACAGGCTAAGGGAGAAGAAAGG - Intergenic
969809979 4:9640169-9640191 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
969846912 4:9926500-9926522 CACACACAAAGTCCTCAGAACGG + Intronic
970438148 4:16055650-16055672 CACAGACAAACCCCTTAGAAAGG + Intronic
970601530 4:17644077-17644099 CACAGGCGAAGGCCAAAGGGAGG + Intronic
970747981 4:19322256-19322278 TCCAGGAAAAGGCATAAGAAAGG + Intergenic
972607980 4:40631031-40631053 CACATGCAAAGAGCTTAGAACGG + Intergenic
972732273 4:41806709-41806731 CACAATCAAAGCCCTAAGGATGG - Intergenic
972838612 4:42905150-42905172 CCAAGGCAAAGGCCTAGGTAGGG - Intronic
973216570 4:47675987-47676009 CACATGCAAAGGCCTAGAATAGG + Intronic
973281027 4:48361650-48361672 AAAATGCAAAGGCCAAAGAACGG - Intronic
973750982 4:54021076-54021098 CACAGGCTAAGGGAGAAGAAGGG - Intronic
974905803 4:68055106-68055128 CAAATGCAAGGGCCTAAAAAAGG + Intronic
975951467 4:79777241-79777263 AAGACGCAAAGGCATAAGAATGG + Intergenic
977225481 4:94387887-94387909 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
978031332 4:103942411-103942433 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
978521861 4:109624477-109624499 CACATTCAAAGGCCTTAGCAAGG + Intronic
978631353 4:110749701-110749723 CACAGGGAAAGGTTTAAGAAAGG - Intergenic
980284811 4:130768627-130768649 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
981740304 4:147994706-147994728 GACAGACAATTGCCTAAGAATGG - Intronic
982812238 4:159840342-159840364 GACAGTCAATGGCCTAAGCATGG + Intergenic
983669271 4:170216644-170216666 CAAAGAAAAAGGCATAAGAATGG + Intergenic
984625224 4:181999354-181999376 CACAGGCAAAGTTCTGAGACTGG + Intergenic
986242945 5:5977800-5977822 CGCAGGCAGAGACCTCAGAATGG + Intergenic
988382581 5:30516999-30517021 CACAGGCAAAGACCTGAGTGTGG + Intergenic
991255423 5:64608211-64608233 CAGAGGCAAAGGACTATGAGGGG - Intronic
991509271 5:67358957-67358979 CATGGGCAAAGGCCCAGGAATGG - Intergenic
992270307 5:75056047-75056069 CACAGGAAAAGGCCAGAGACTGG - Intergenic
992929570 5:81628828-81628850 GAGAGGCAAAGGCCTCAGAATGG - Intronic
994702953 5:103160660-103160682 CACAGGCCATGAGCTAAGAATGG - Intronic
995501551 5:112812525-112812547 CAAAGGCAGAGGCATAAGCAAGG - Intronic
997096075 5:130913013-130913035 CAGAGGCCAAGGACAAAGAAAGG + Intergenic
997418173 5:133745198-133745220 CACAGGCAAAGCCCTTTCAATGG + Intergenic
999495632 5:152094015-152094037 GAGTGGCAAAGGCCCAAGAAGGG - Intergenic
999663356 5:153888521-153888543 CACAGCCCAAGTCCTAATAATGG - Intergenic
1000438448 5:161241235-161241257 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1000439573 5:161249737-161249759 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1003310512 6:4965879-4965901 CAGGAGCAAAGCCCTAAGAAAGG - Intergenic
1003646253 6:7915116-7915138 CACACACAAGGGCCTGAGAAGGG - Intronic
1004029545 6:11852853-11852875 ACCAGGCAGAGGCCTAAAAATGG + Intergenic
1004768722 6:18758498-18758520 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1005786722 6:29251672-29251694 CACAGGCTAAGGGAGAAGAAAGG + Intergenic
1006219268 6:32474336-32474358 CACAGGCAAGGGGCTAACAGGGG + Intergenic
1006777798 6:36609726-36609748 CTCAGGTAATGGCTTAAGAAAGG + Intergenic
1007060189 6:38932896-38932918 CACAGGCACAGGCCCTTGAAAGG + Intronic
1007791365 6:44310656-44310678 CCCAGGCAAGGGCCCAAGCAGGG - Intronic
1008300156 6:49827420-49827442 CTCAGCCAAAGGGTTAAGAAGGG + Intergenic
1009277426 6:61701095-61701117 CACTGGCAATGGCATAACAAGGG - Intronic
1010865341 6:80969624-80969646 CACATGTAAAGGCCTAATTAAGG - Intergenic
1010962876 6:82166567-82166589 CACACCCTCAGGCCTAAGAATGG - Intergenic
1010963864 6:82179935-82179957 CACAGGTATTGGCCTAAGATAGG + Intronic
1011368046 6:86602784-86602806 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1015156399 6:130101459-130101481 AACTGCCAAAGGCCTGAGAAAGG - Intronic
1015831083 6:137369669-137369691 CACATTCACAGGCCTATGAACGG + Intergenic
1017269667 6:152491460-152491482 CACAGGCTAAGGGAGAAGAAGGG - Intronic
1018752374 6:166818618-166818640 CACAGGCAACGGTCTCTGAATGG - Intronic
1019338065 7:494470-494492 CACAGGCCCAGTCCTGAGAACGG - Intergenic
1019906551 7:4069391-4069413 CACAGGCAAAGCCCCCAGAGAGG - Intronic
1020567941 7:9821729-9821751 GAAAGGCAATGGCCTAAGTAAGG + Intergenic
1021297951 7:18932581-18932603 CAGAGGCTTGGGCCTAAGAAGGG + Intronic
1021637172 7:22704537-22704559 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1021660471 7:22914397-22914419 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1021885760 7:25137159-25137181 CACTTGCTAAGGCCTAATAAAGG - Intronic
1022447265 7:30480517-30480539 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1023217656 7:37882154-37882176 CACAGGCAAATTTCTAAGTAAGG - Intronic
1024985575 7:55190862-55190884 CCCAGGCTTTGGCCTAAGAATGG - Intronic
1026320410 7:69263109-69263131 CACAGCCAAAGTCCTCAGCAAGG + Intergenic
1028590052 7:92484251-92484273 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1029595189 7:101533927-101533949 CACAGGCAAAAGCCAAAGCCAGG + Intronic
1030686470 7:112492306-112492328 CACAGCCAAAGTCCAAAGAATGG - Intergenic
1030828458 7:114190480-114190502 CACACCAAAAGGCCTAAGACGGG - Intronic
1031355340 7:120781570-120781592 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1032561955 7:132901464-132901486 CAAAGGCAAAGGCCACAGGAGGG + Intronic
1033258019 7:139818638-139818660 CCCAGGCACAGGCCCAATAATGG - Intronic
1033552459 7:142459913-142459935 CAGAGGAAAAGGCGAAAGAAAGG + Intergenic
1033577632 7:142701478-142701500 TACAGGCAAAGGCAGAAGGAGGG + Intergenic
1033625435 7:143106087-143106109 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1033736712 7:144229507-144229529 CACAGGCAACCGCCTGAGCATGG + Intergenic
1033746345 7:144321443-144321465 CACAGGCAACCGCCTGAGCATGG - Intergenic
1034084976 7:148314493-148314515 CACAGGCTAAGGGAGAAGAAGGG + Intronic
1034351038 7:150414923-150414945 CACACAGAAAGGCCAAAGAAAGG - Intergenic
1034420827 7:150989706-150989728 CACTGGCCACGGCCCAAGAAAGG + Intergenic
1035045697 7:155964006-155964028 CACAGACAAAGGCCTAAGGCCGG + Intronic
1036220031 8:6913806-6913828 CTGAGGCAAAGGCCAGAGAAAGG + Intergenic
1036472484 8:9063891-9063913 CACAGGCTAAGGGAGAAGAAGGG + Intronic
1036486581 8:9184772-9184794 CACAGGAAAAAGCCTTTGAAAGG - Intergenic
1037789160 8:21920608-21920630 GACAGGCACAGGCCCTAGAAAGG + Intronic
1038499570 8:28032292-28032314 CACAAGCAAAGGCTGGAGAATGG + Intronic
1038505033 8:28076743-28076765 CACAGGTAAAGGCAGAAGATGGG + Intronic
1041684000 8:60625713-60625735 CATGGGCAAAAGCCTGAGAAAGG + Intergenic
1042570232 8:70156213-70156235 CACAGGCAAAGACCTGAGCCAGG - Exonic
1043208967 8:77486458-77486480 AAGATGCAAAGGCATAAGAATGG + Intergenic
1043739987 8:83799687-83799709 CAAAGACAAAGGACAAAGAAAGG - Intergenic
1044737876 8:95297575-95297597 CACAGCCACAAGCCAAAGAATGG - Intergenic
1044766386 8:95579770-95579792 CTTAGGCAAATGCCTAGGAATGG - Intergenic
1047185406 8:122628617-122628639 CATAGGCAAAGGCCTAAAGGAGG + Intergenic
1048224786 8:132574755-132574777 CACAAGTAAAGGCCTTAGCATGG - Intronic
1048517443 8:135123764-135123786 TTCAGGCAAAGTCCTAAGGAAGG - Intergenic
1049564044 8:143328670-143328692 CACATGCAAAGGCCTAAAACAGG + Intronic
1049690694 8:143957667-143957689 CACAGGCCCAGGCCAAAGAAGGG + Intronic
1050266728 9:3898633-3898655 CAGAGTAAAAGGCCTAAAAAAGG + Intronic
1050276995 9:4010377-4010399 TACAGGCAAAGCCCTCAGACTGG + Intronic
1051065174 9:13093898-13093920 CACAGGCAATGGCGTGGGAAAGG + Intergenic
1051535680 9:18154840-18154862 CTCAAGAAAATGCCTAAGAAAGG - Intergenic
1052112714 9:24608611-24608633 CACACGCAAAGACAGAAGAATGG - Intergenic
1053060112 9:35024081-35024103 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1053191860 9:36078216-36078238 CAGAGGCCAAGGCCTAGAAAGGG - Intronic
1053566308 9:39256439-39256461 CACAGCCAGAGAACTAAGAATGG + Intronic
1053597587 9:39578724-39578746 CAAAGGGAAAGGGCTAAGGAAGG + Intergenic
1054130840 9:61362574-61362596 CACAGCCAGAGAACTAAGAATGG - Intergenic
1054568677 9:66786277-66786299 CAAAGGGAAAGGGCTAAGGAAGG - Intergenic
1055199869 9:73646837-73646859 CACAGGCACAGGCCCAGGGATGG + Intergenic
1055209442 9:73771947-73771969 CACAGGCATAGGGCTGTGAAAGG - Intergenic
1055347867 9:75356225-75356247 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1055962341 9:81832608-81832630 CCCAGGCACAGGCCAAAAAATGG + Intergenic
1056298446 9:85217340-85217362 CTCTTGCAAAGGCCTAAGGAAGG - Intergenic
1056363567 9:85881951-85881973 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1057576984 9:96250547-96250569 CAAAGGTCAGGGCCTAAGAAAGG + Intronic
1058230726 9:102420736-102420758 TCCAGGCAAAGGACTAGGAATGG + Intergenic
1059316277 9:113428413-113428435 CACATGCAGAGGCCTCAGGAAGG - Intronic
1060318612 9:122535032-122535054 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1060720857 9:125976294-125976316 GAAACGCAAAGGGCTAAGAATGG - Intergenic
1060788832 9:126471720-126471742 CACAGGAAAGGGGCGAAGAAAGG + Intronic
1062008252 9:134252588-134252610 CACAGGCAGAGGTCAAGGAATGG + Intergenic
1186522501 X:10218665-10218687 AACAGGCAAAAGCCTGTGAATGG - Intronic
1187832654 X:23398661-23398683 CGCTGGCAAAGAACTAAGAATGG + Exonic
1188419338 X:29976550-29976572 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1188430880 X:30104618-30104640 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1189234415 X:39476517-39476539 CACACGCAAGGGCTTGAGAAGGG + Intergenic
1189933954 X:46044927-46044949 AGGAGACAAAGGCCTAAGAATGG + Intergenic
1191805955 X:65134099-65134121 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1192049501 X:67711010-67711032 CAGAAGCAAAGGTCTAACAATGG + Intronic
1192695209 X:73406560-73406582 AACAGGCAAAGGTCTGACAAAGG + Intergenic
1193722992 X:85008327-85008349 CACAGGCAAAGGTAAAGGAAAGG - Intronic
1195941082 X:110168505-110168527 CACAGCCAAAGTCATAAGAGCGG - Intronic
1196525627 X:116725410-116725432 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1197470818 X:126864370-126864392 CACAGGCTAAGGGAGAAGAAGGG - Intergenic
1197593338 X:128436705-128436727 CATATGCAAAGGCCTATGAGCGG + Intergenic
1199370232 X:147039225-147039247 CACACACAAAAGCCTAAGGAAGG + Intergenic
1199521387 X:148740576-148740598 CAAAGGCAAAGCCCAATGAAAGG - Intronic
1200256683 X:154586105-154586127 CACAGGCCAAGTCCTAGGAGAGG + Intronic
1200261086 X:154618298-154618320 CACAGGCCAAGTCCTAGGAGAGG - Intronic
1201061794 Y:10052744-10052766 CACAGGCTAAGGGAGAAGAAGGG + Intergenic
1201540813 Y:15103053-15103075 CACAGGCTAAGGGAGAAGAAGGG + Intergenic