ID: 926643307

View in Genome Browser
Species Human (GRCh38)
Location 2:15260995-15261017
Sequence CTGAGTTATAACTCACTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926643307_926643312 30 Left 926643307 2:15260995-15261017 CCCACTAGTGAGTTATAACTCAG 0: 1
1: 0
2: 1
3: 6
4: 75
Right 926643312 2:15261048-15261070 ATGATAACAGGATGGCTTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 103
926643307_926643310 18 Left 926643307 2:15260995-15261017 CCCACTAGTGAGTTATAACTCAG 0: 1
1: 0
2: 1
3: 6
4: 75
Right 926643310 2:15261036-15261058 AAATCTGCTCTGATGATAACAGG 0: 1
1: 0
2: 2
3: 12
4: 153
926643307_926643311 22 Left 926643307 2:15260995-15261017 CCCACTAGTGAGTTATAACTCAG 0: 1
1: 0
2: 1
3: 6
4: 75
Right 926643311 2:15261040-15261062 CTGCTCTGATGATAACAGGATGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926643307 Original CRISPR CTGAGTTATAACTCACTAGT GGG (reversed) Intronic
902698224 1:18154638-18154660 CTGGGTTAGAACTCACTTGAAGG + Intronic
904890448 1:33775656-33775678 CTGAGTTTTAAGGTACTAGTGGG + Intronic
910329250 1:86050859-86050881 CTTAGTTATATCTCACTTGTGGG + Intronic
1070873749 10:79781907-79781929 CTGAGTAATAACAACCTAGTTGG - Intergenic
1071640682 10:87304057-87304079 CTGAGTAATAACAACCTAGTTGG - Intergenic
1071654554 10:87433888-87433910 CTGAGTAATAACAACCTAGTTGG + Intergenic
1072399884 10:95087017-95087039 CTGGCCTATAACTCACTATTAGG + Intergenic
1074578589 10:114694502-114694524 CTGGTTTACCACTCACTAGTTGG + Intergenic
1076109570 10:127850561-127850583 CTGAGTGGGAACTCACTAGATGG + Intergenic
1079834218 11:25311178-25311200 CACAGTTATAAGTCATTAGTTGG - Intergenic
1080025005 11:27604259-27604281 CTGAGTTAGAACTGCCTTGTAGG - Intergenic
1080292109 11:30682650-30682672 CTGAATTAAAACTGACAAGTAGG + Intergenic
1082868928 11:57925566-57925588 CTGAGTTCTCACTCACAAGTGGG - Intergenic
1085899403 11:80680200-80680222 CTGAGATGTAACTGACAAGTAGG - Intergenic
1088140435 11:106609295-106609317 CTGAATTATGTCTCATTAGTTGG + Intergenic
1089531061 11:119129802-119129824 CTGTGTTGTGACCCACTAGTGGG - Intronic
1090587269 11:128226664-128226686 CTGATTTATAAATCACTAATAGG + Intergenic
1098952241 12:76652678-76652700 CTAAGCTATAACTCTCTAGCAGG + Intergenic
1101848123 12:108379976-108379998 CTTAATCATAACTCACTGGTGGG - Intergenic
1102511443 12:113418294-113418316 CACAGTTATTACTCACTAGCTGG + Intronic
1132159081 15:99520088-99520110 CTGAGTTGTAACTAACTAGTGGG + Intergenic
1136994000 16:35175126-35175148 CTGAATTATAACTAACTGGTAGG - Intergenic
1138355305 16:56373033-56373055 CTGACTTATAACTGACAAATTGG + Intronic
1139022713 16:62771165-62771187 CTGAGTTATTACACTGTAGTAGG + Intergenic
1140258886 16:73360060-73360082 CTGAGTTATCACTTATTAGTTGG + Intergenic
1143211808 17:5193591-5193613 ATGAGTTAGAACTCATAAGTGGG + Intergenic
1146146859 17:30426508-30426530 CTGAGTTACAACTCACTCACTGG + Intronic
1158171996 18:54610425-54610447 CTGAGATAAAACCCACTATTTGG + Intergenic
926643307 2:15260995-15261017 CTGAGTTATAACTCACTAGTGGG - Intronic
930312712 2:49761840-49761862 CTGAATTAATACTCACTGGTGGG + Intergenic
936635546 2:114252353-114252375 CAGAGTTAGAACTCATTACTGGG - Intergenic
937844144 2:126559039-126559061 CTGAATAAAAACTCACTAGAGGG + Intergenic
947890685 2:233616644-233616666 CTGAGAAATCACTCACTATTGGG + Intergenic
1179910792 21:44447114-44447136 CTGAGATATAATTCACAAATAGG - Intergenic
1180743357 22:18069270-18069292 CTGAGTTCTCATGCACTAGTTGG - Intergenic
956322713 3:68015727-68015749 TAAATTTATAACTCACTAGTGGG - Intronic
957363791 3:79194902-79194924 CTGAGTTATGAATAACAAGTAGG + Intronic
957401967 3:79727148-79727170 CTGAGGCATAATTCTCTAGTGGG - Intronic
960899572 3:122541188-122541210 CTGTTTTAAAACCCACTAGTCGG - Intronic
960932372 3:122866571-122866593 GTCAGTTATAACTCACTGGGAGG - Intronic
965292508 3:166901473-166901495 CAGAGATATAATTCACTAGGAGG - Intergenic
966368787 3:179223350-179223372 CTGAGTTATCACGCAATAGCTGG - Intronic
973259503 4:48147792-48147814 CTGGGTTGTAACTCAATAATAGG + Intronic
973276493 4:48315311-48315333 CTGAGTAAGAACTCACTCCTGGG - Intergenic
975110929 4:70625705-70625727 CTGAGCTAGAACTCAGTGGTGGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
976569143 4:86588872-86588894 CTGAGTCATAACATACTAGAAGG - Intronic
985329909 4:188820480-188820502 ATTTGTTATAAGTCACTAGTGGG - Intergenic
989080953 5:37620687-37620709 CTGGATTCTAACTCATTAGTGGG - Intronic
989117710 5:37971737-37971759 CTGATTTACAAATCACTAATGGG - Intergenic
989375962 5:40761164-40761186 CTTGGTTATAACTCTTTAGTTGG - Intronic
992682305 5:79165320-79165342 TTGAGGTATAACTCATTTGTTGG + Intronic
997262819 5:132477230-132477252 CTGTGTAAGAACTCACTACTTGG + Intergenic
1000843003 5:166244964-166244986 CTTATTTATAACTCACTTGAAGG - Intergenic
1004641223 6:17517576-17517598 GTGAGATATGACTCACTAGTGGG - Intronic
1007253028 6:40509387-40509409 GTGAGTCATAACCCACTTGTGGG + Intronic
1012487556 6:99739058-99739080 CTGAGTTAGAACTGCCCAGTTGG + Intergenic
1012929837 6:105305516-105305538 CTGGGAAGTAACTCACTAGTGGG + Intronic
1015132527 6:129830047-129830069 CTGATTTATAGATCACTAGAGGG - Intergenic
1015423280 6:133035863-133035885 CTAAGTAATAACTGGCTAGTAGG + Intergenic
1016554596 6:145322220-145322242 CTGAGTTTTGACTCCCTAATGGG - Intergenic
1027540216 7:79455416-79455438 CTTAGGTATAACTTACTACTTGG + Intergenic
1027576163 7:79933813-79933835 CTGAGTGAGACCTCACTACTGGG - Intergenic
1032026578 7:128447344-128447366 CTGAGTTGAAACTGTCTAGTTGG + Intergenic
1032271657 7:130413641-130413663 CTGAGCTATAACTCACATATAGG + Intronic
1041020357 8:53632538-53632560 CTGGGTTCTGACTCACTAGGAGG - Intergenic
1041658856 8:60381246-60381268 CAGAGTAAAAACTCACTATTAGG + Intergenic
1042009373 8:64223174-64223196 CTGAGTCAAAAATCTCTAGTAGG - Intergenic
1042581167 8:70280781-70280803 ATGAGGCATAACTAACTAGTAGG - Intronic
1043757860 8:84026625-84026647 CTGAATTATAACTCAAAACTAGG - Intergenic
1043836755 8:85056538-85056560 CTCTATTATTACTCACTAGTTGG + Intergenic
1047060743 8:121222151-121222173 CTTAATTATATTTCACTAGTTGG - Intergenic
1047080647 8:121456025-121456047 CTGCATTATAACTAACTAGCAGG + Intergenic
1048239427 8:132726588-132726610 CTGAGTTATAGCTAAGGAGTAGG + Intronic
1050489164 9:6169131-6169153 CTGCGTCATATATCACTAGTAGG + Intergenic
1053338513 9:37301050-37301072 CTGAATAATATCTCACTAATAGG - Intronic
1056518775 9:87380701-87380723 TTGAGTTTTAACTGACTAGCAGG - Intergenic
1187045282 X:15642086-15642108 CTGAGTTATATCTTAGCAGTGGG - Intronic
1193540144 X:82761254-82761276 CAGAGTTCTCACTCACAAGTGGG - Intergenic
1195476759 X:105295544-105295566 CTGATTTATAACCTACTAATGGG - Intronic
1197843867 X:130779792-130779814 CTCAGTTATAACTCCCCTGTTGG - Intronic
1198208628 X:134494484-134494506 CTGACATATGACTCACTAGAAGG - Intronic
1199509784 X:148609056-148609078 CTGAACTAGATCTCACTAGTTGG - Intronic