ID: 926646268

View in Genome Browser
Species Human (GRCh38)
Location 2:15292868-15292890
Sequence TGAAATGGCAATAGTGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926646268_926646272 -8 Left 926646268 2:15292868-15292890 CCCTGTACACTATTGCCATTTCA 0: 1
1: 0
2: 1
3: 23
4: 181
Right 926646272 2:15292883-15292905 CCATTTCATAAGGCTCACAACGG 0: 1
1: 0
2: 2
3: 7
4: 162
926646268_926646275 18 Left 926646268 2:15292868-15292890 CCCTGTACACTATTGCCATTTCA 0: 1
1: 0
2: 1
3: 23
4: 181
Right 926646275 2:15292909-15292931 TGAAAAGTCAGTTGCAGAAGTGG 0: 1
1: 0
2: 2
3: 28
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926646268 Original CRISPR TGAAATGGCAATAGTGTACA GGG (reversed) Intronic
900849281 1:5129623-5129645 GGAAATGGAAATAATGTAAATGG + Intergenic
906222564 1:44093227-44093249 TTAAATGGCAATAGAGTAACAGG + Intergenic
907631062 1:56082437-56082459 TGTAATGGAAATAACGTACAAGG - Intergenic
907742584 1:57181552-57181574 GGGAATGGAAATACTGTACAAGG + Intronic
911647840 1:100354198-100354220 TGGAGTGGCCATAGGGTACAGGG + Intronic
913087492 1:115452308-115452330 TTAAATGAAAAAAGTGTACATGG - Intergenic
915772028 1:158435257-158435279 TGAAATGGGAATAGTTGAAAAGG + Intergenic
921465311 1:215480026-215480048 TGAAATGCCTATCATGTACATGG - Intergenic
921837017 1:219788534-219788556 TGAAGTGGCAAGAGTGAGCAGGG + Intronic
923744663 1:236688873-236688895 TGAAATGGCAAGTGTGGAGAAGG - Intronic
1063794455 10:9496299-9496321 TGAAGTGACAGAAGTGTACAAGG - Intergenic
1064200370 10:13279349-13279371 TGAGATGATAATAGTGAACATGG + Intronic
1064670783 10:17711843-17711865 TTAAATGGCAGTAGCGTAGATGG + Intronic
1064750138 10:18520151-18520173 TGAATAGGCAATTGTATACATGG - Intronic
1068057715 10:52031964-52031986 TGAAATGGCTGGAGTGTAGAGGG + Intronic
1068303294 10:55174504-55174526 TGAGATGGCCAAAGTGTCCAAGG + Intronic
1068638808 10:59378683-59378705 AGAAATGGAAAAAGAGTACAAGG - Intergenic
1068971386 10:62961981-62962003 TGAAATGACAATAATCTTCATGG + Intergenic
1072901994 10:99416500-99416522 GAAAATGGCCATACTGTACAAGG + Intronic
1075537944 10:123286847-123286869 TGAAATGGTACTACTGGACAAGG - Intergenic
1075869921 10:125764340-125764362 TGTAATGGCTACAGTGCACAAGG + Intergenic
1077824380 11:5788691-5788713 TGTAATAGCAATGCTGTACATGG + Exonic
1078153742 11:8780458-8780480 TCAAATGGCAAAAGAATACAGGG + Intronic
1078811084 11:14764102-14764124 TGAAGAGGCAAGAGTGGACATGG + Intronic
1081372102 11:42316618-42316640 TCAAATGGCAATAGCTTTCAAGG - Intergenic
1082911465 11:58380320-58380342 TAAAATGGCCATACTGTCCAAGG + Intergenic
1083005890 11:59345756-59345778 TAAAATGGCCATACTGTCCAAGG - Intergenic
1084088608 11:66866042-66866064 TGAAGTGGACATAGAGTACACGG - Intronic
1084444377 11:69195193-69195215 TGATATGGCAATAGTGGTGATGG + Intergenic
1086017660 11:82186363-82186385 TGAGAATGCAATAGTGAACAAGG + Intergenic
1086409544 11:86530406-86530428 GGAAATGGCCATAGTGCCCAAGG + Intronic
1087479806 11:98684959-98684981 GGTAATGGCAACAGTGTACAAGG + Intergenic
1087894019 11:103567634-103567656 TGAAATGGCAATAGATCAGATGG + Intergenic
1087929828 11:103964386-103964408 TGAAATAGCAATAGTTTGCTAGG - Intronic
1088431288 11:109761701-109761723 TAAAATGGCCATATTGCACAAGG - Intergenic
1093219303 12:16399843-16399865 TGATATGGTAATTGTCTACAAGG - Intronic
1093568241 12:20634381-20634403 TGAAATGGCGACAGTGAAGAAGG + Intronic
1097294493 12:57947981-57948003 TGAAGTGGCAATATAGAACAAGG + Intronic
1099760079 12:86909954-86909976 TGATATGGCAGTATTGTATAAGG + Intergenic
1101476413 12:105053310-105053332 TAAAATGGCACCAGTGTAAAAGG - Intronic
1103027635 12:117586788-117586810 TGAAATGGCACTAATGATCATGG - Intronic
1107885442 13:44871176-44871198 GGAGATGGCAAAAGTGGACAGGG - Intergenic
1110681008 13:78311740-78311762 TGAATTGACAATATTGTACAGGG + Intergenic
1111299051 13:86322596-86322618 TGAAATGGCCATACTGCCCAAGG - Intergenic
1112206928 13:97333620-97333642 TGAAGAGGCAATAGTGTGCAGGG - Intronic
1112517671 13:100069110-100069132 TGAGATGGGAATAGGGAACAGGG + Intergenic
1112655513 13:101448425-101448447 GGCTATGGCAATAGTGTACGAGG + Intergenic
1113005098 13:105692031-105692053 TGAAAAGCCCATAGTGTTCACGG - Intergenic
1113018104 13:105851252-105851274 AGATATGGCAATAGAGTATATGG - Intergenic
1114299005 14:21357270-21357292 TGATATGGTAATCGTCTACAAGG - Exonic
1114375493 14:22142170-22142192 TAAAATGACTATAGTGTAAACGG - Intergenic
1115014334 14:28591563-28591585 TGAAATGGCAATAGTGCCTATGG + Intergenic
1115349466 14:32378133-32378155 TAAAATGGCAATATTTTGCATGG + Intronic
1116948574 14:50858257-50858279 TGAAATGGCTATAGTGTCCTTGG - Intronic
1116973170 14:51089421-51089443 TGTAATGAAAATAATGTACAGGG - Intronic
1117415768 14:55494094-55494116 TGAAATGGCAATACTGCCCAAGG - Intergenic
1117489585 14:56233161-56233183 TGAAATGGCCATACTGCCCAAGG + Intronic
1118013217 14:61631367-61631389 TGAAGTAGAAATAGTGTCCATGG - Intronic
1118581895 14:67308946-67308968 TGAAATGGGGATAGGGTACAGGG - Intronic
1118916062 14:70107349-70107371 TGAAATGGCTATTCTGTTCAAGG - Intronic
1120286131 14:82504452-82504474 TGAAATATCAATAGTTAACAAGG + Intergenic
1120784812 14:88523552-88523574 TCAAATGGCAGTGGTGAACATGG - Intronic
1121878100 14:97473319-97473341 TCAATTGGCATTAGTGTCCATGG - Intergenic
1125219231 15:37314208-37314230 TGAAATGGCCATACTGCCCAAGG - Intergenic
1125389937 15:39181348-39181370 TAAAATGGCAATAGTTGAGAAGG + Intergenic
1126391410 15:48158570-48158592 TGAATTGGCCATATTGTACAGGG - Intronic
1130776744 15:86992139-86992161 TCACATGGCAAGAGTGAACAAGG + Intronic
1135097259 16:19574814-19574836 TCAAATGGCAGTAGTGTAGAGGG + Intronic
1139280903 16:65769640-65769662 TGAAAGGACAAAAATGTACATGG - Intergenic
1146304771 17:31722511-31722533 TGAAATGGTGATAATTTACAAGG + Intergenic
1146702243 17:34971266-34971288 CCAAATGTCAATAGTGTAGAGGG - Intronic
1146752911 17:35398350-35398372 GAAAATGGCCATAGTGTCCAAGG + Intergenic
1149315562 17:55435193-55435215 TCAAATGCCTATAGTGTATAAGG + Intergenic
1149463465 17:56853697-56853719 TGCAATGCCAATAGTGTATAAGG - Intronic
1151416913 17:73972581-73972603 TGACATGGGACTAGTGTACAGGG - Intergenic
1155376441 18:25163625-25163647 TGAAATGGGCACTGTGTACATGG - Intronic
1155523264 18:26690569-26690591 TGAAATGAGAATAGTGTACAGGG + Intergenic
1157979220 18:52361823-52361845 TGAATTAGCAATGGTGTGCAGGG + Intronic
1158683136 18:59586982-59587004 TGAAATGGAAACCGTGAACATGG + Intronic
1164928929 19:32157579-32157601 TGAAATGGAAATAGTCCTCATGG + Intergenic
1165692889 19:37877433-37877455 TAAAATGGCAATATTATACAAGG + Intergenic
926026379 2:9548631-9548653 TGAAATTGCAACTGTGTATAAGG - Intronic
926646268 2:15292868-15292890 TGAAATGGCAATAGTGTACAGGG - Intronic
926694603 2:15762528-15762550 TCAAATGGCAAGACTGGACAGGG + Intergenic
928366848 2:30709445-30709467 GGAAATGTCAATATTGTACCTGG + Intergenic
928495326 2:31825699-31825721 TGAAATGGCCATACTGCCCAAGG + Intergenic
932383360 2:71306662-71306684 CAAAATGGTAATAGTGTACATGG + Intronic
933274911 2:80273428-80273450 TGAAAGGGCAATGGTGAAAATGG - Intronic
933542204 2:83660967-83660989 GGAAATGGCAAGAGTGGATATGG + Intergenic
937352938 2:121178509-121178531 TGAAGTGGCTATAGTGTCCGGGG + Intergenic
937654928 2:124363977-124363999 TGAAGTGACAATAGTCTCCAAGG - Intronic
938667235 2:133551151-133551173 TGAAATGGCCATACTGCCCAAGG + Intronic
939651214 2:144764741-144764763 TGTAATGGCAATAGTGGATCTGG + Intergenic
940094360 2:149957394-149957416 TCACATGGCAAGAGTGTTCATGG - Intergenic
940424662 2:153516648-153516670 TGAAATGGCAATTTTATAGAGGG + Intergenic
940686106 2:156852857-156852879 TGAAATGGCAACTGAGTACCAGG - Intergenic
947213937 2:227733070-227733092 TGAAATGGCCATACTGCCCAAGG + Intergenic
947238920 2:227973233-227973255 TCAAAGGACAGTAGTGTACACGG - Intergenic
1169648260 20:7838573-7838595 TGAACTGGTATTAATGTACAAGG - Intergenic
1170273300 20:14552807-14552829 AGAAATGGTAATTGTGTATAGGG + Intronic
1173350621 20:42242002-42242024 TGAAATGGAAATAGAGTTTAAGG - Intronic
1177298154 21:19203959-19203981 TGAAATGTCCATTGTGCACATGG - Intergenic
1177348885 21:19909532-19909554 TGATATGGCAATACTGAAAAAGG - Intergenic
1180279808 22:10683203-10683225 TCAAATGGAAATGGTGTATAAGG - Intergenic
1183132511 22:35852581-35852603 TGAAATGACAGAAGTGTACAGGG - Intronic
949094210 3:66524-66546 TGAGATGGCAATATTGAAAACGG + Intergenic
951123710 3:18959389-18959411 GAAAATGGCCATAGTGCACAAGG - Intergenic
952935696 3:38396824-38396846 TGAAATGGCTAAAAAGTACAGGG + Intronic
953349835 3:42207114-42207136 TGACGTGGCCATATTGTACATGG + Intronic
953619329 3:44519427-44519449 TGAAAGGGCGATAGTTTACCTGG + Intergenic
954505954 3:51073381-51073403 TGCAAAGGCAGTAGTGTTCACGG - Intronic
956072903 3:65473333-65473355 TAAAATGGGCATAATGTACATGG + Intronic
956180309 3:66511442-66511464 TGAAAAGCCAAGAGTGGACAAGG + Intergenic
957826562 3:85453925-85453947 AGAAACGGCAATATTTTACATGG + Intronic
959852109 3:111099794-111099816 TGTAGTGGCACTAATGTACAAGG - Intronic
960658285 3:120030093-120030115 TGAAATAGCAATAGGGAACAAGG - Intronic
962088850 3:132221603-132221625 TAACATGTCAATAGAGTACATGG - Intronic
962800311 3:138884761-138884783 TGAAATGGAATGAGTGTTCATGG - Intergenic
963538536 3:146558733-146558755 CAAAATGGAACTAGTGTACAAGG + Intergenic
963585292 3:147178965-147178987 TGCAATGTCAATACTGTACCTGG + Intergenic
964019523 3:151992077-151992099 TGAAAAGGCAGGAATGTACATGG - Intergenic
967266300 3:187695242-187695264 TGAAATGGCAATAGTCCAAGGGG + Intergenic
967637818 3:191824718-191824740 TTAAATGGCCATACTGTCCAAGG + Intergenic
967798067 3:193620551-193620573 TTAAAAGGAAATAGTTTACAAGG - Intronic
968141778 3:196263971-196263993 TGAAATGGCAATAGGAGTCAGGG - Intronic
969517870 4:7658615-7658637 TGAAATCTCAATAGACTACAGGG + Intronic
970454389 4:16207886-16207908 TTAAATAGCTATAATGTACAAGG + Intronic
970668402 4:18366009-18366031 GGAAATGGAAATGGTGTTCAAGG - Intergenic
971464395 4:26940041-26940063 TGAAATGGGAATAGTTTTCATGG + Intronic
972144477 4:36005054-36005076 TCAAATGGCAATAATATACAAGG - Intronic
972196578 4:36660589-36660611 GGAAATGGCCATATTGTCCAAGG + Intergenic
972430952 4:38981556-38981578 TGTAATGTCAATAGTGAACTGGG - Intronic
974619509 4:64337839-64337861 TGAAATGGCCATACTGCCCAAGG + Intronic
977956525 4:103033864-103033886 TAAAATGGCCATATTGTCCAAGG + Intronic
981230284 4:142345542-142345564 TGAAGTGGGAATAGTACACATGG + Intronic
983679784 4:170340069-170340091 TGAATTGTCATTACTGTACAAGG + Intergenic
983682742 4:170372301-170372323 TGAAATGGGTTTAATGTACATGG - Intergenic
984471821 4:180185604-180185626 TCAAAAGGCAGTTGTGTACAAGG + Intergenic
987775225 5:22357155-22357177 TGACAAGGCAAAAGTGAACATGG + Intronic
987857425 5:23438907-23438929 TGATAGGGCAATAGTGTATTCGG - Intergenic
988888745 5:35590083-35590105 TGGAATGGCAATCCTGTCCAGGG + Intergenic
989757087 5:44968363-44968385 TGAAAGGGTAAAAGTATACAGGG + Intergenic
990890822 5:60647987-60648009 TAAAATGTCTATAGTGTTCAAGG + Intronic
993212885 5:84976980-84977002 TGAAATGGCCATACTGCCCAAGG - Intergenic
995367013 5:111373757-111373779 TGAACTAGCAAGAGTTTACATGG - Intronic
995692411 5:114842349-114842371 GGAAATGGCCATACTGTCCAAGG + Intergenic
996441319 5:123494537-123494559 TAAACTGGGAATAGTGTACAAGG + Intergenic
999076198 5:148797896-148797918 TGAAATCAAAATAGTCTACAAGG + Intergenic
999124165 5:149234446-149234468 TGATCTGGCAGTAGTGGACAGGG - Intronic
999946821 5:156606630-156606652 GGAAATGGCCATACTGTCCAAGG - Intronic
1001277669 5:170362309-170362331 AGAAATGGAAAGAGTGTACTGGG - Intronic
1002911852 6:1496957-1496979 TGAAATTGAAATACTATACAGGG + Intergenic
1003869036 6:10387391-10387413 TGAAATGGCACTAATTTCCAAGG + Intergenic
1004976930 6:20978393-20978415 TGAAATGGCAAGACTGTGAAAGG - Intronic
1006858411 6:37152442-37152464 CAAAATGGCAATAGTTTTCAAGG - Intergenic
1007065033 6:38981573-38981595 TGAAATGGCAAGATTGCAAAGGG + Intronic
1007118962 6:39364692-39364714 AGAATTAGCAATAGGGTACATGG - Intronic
1007299716 6:40857637-40857659 TGAGAAGGCAACAGTGTACAGGG - Intergenic
1007878438 6:45134183-45134205 TGAAAGGGCAAGAGAGTGCAAGG + Intronic
1007888591 6:45262132-45262154 TAAAATGGCCATACTGCACAAGG + Intronic
1009206237 6:60805071-60805093 GAAAATGGCAATAGTGCCCAAGG - Intergenic
1010079982 6:71849742-71849764 TAAAATGGAAATAGTGCAGAAGG + Intergenic
1010108744 6:72199387-72199409 GAAAATGGCAATAATGTGCAAGG - Intronic
1010154062 6:72771404-72771426 TTAAAAGCCAATAGTGTACAAGG + Intronic
1012705556 6:102524117-102524139 TGAAATTGCAATTGTTTATAAGG + Intergenic
1013218521 6:108053981-108054003 AGAGATGGCAATAATCTACAAGG + Intronic
1016278606 6:142385649-142385671 TGAGAAGGCAATAGGATACAGGG - Intronic
1016502091 6:144733198-144733220 CCAAATGGCAGTAATGTACAAGG - Intronic
1016796293 6:148121465-148121487 TGACATGGCAACAGTGTCCCAGG - Intergenic
1018030227 6:159835976-159835998 TAAAATGGCAATAATGTAACAGG + Intergenic
1022291890 7:29013057-29013079 TGAAATGGAAATAATGTTCTGGG + Intronic
1022330341 7:29372930-29372952 TGAAATCGCTATAGTGAATATGG + Intronic
1022867403 7:34435855-34435877 TGAAATGGCCATACTGCCCAAGG + Intergenic
1027680772 7:81218655-81218677 TGAAATGGCAATTTTGTCTATGG - Intergenic
1029970713 7:104786010-104786032 TGACATGGACACAGTGTACATGG - Intronic
1031310064 7:120185164-120185186 TGAAGAGGCAAAAATGTACAGGG - Intergenic
1032958231 7:136999083-136999105 TGAATTAGCAACAGTGTTCATGG - Intronic
1037274579 8:17163996-17164018 TCAAATGGCAGTAGTGAAAAGGG + Intronic
1039640040 8:39209660-39209682 TGAAATGGCAGCAGTGACCATGG - Intronic
1039696391 8:39917132-39917154 TTAAATGTCAATAGTGGACTAGG - Intronic
1040730017 8:50433375-50433397 TTGAATGGCAATGGTGAACAGGG + Intronic
1042323791 8:67506754-67506776 TGAAATGGACATTGTGTAAAGGG + Intronic
1048180392 8:132189168-132189190 GGACATGGCAAAAGTGGACAGGG - Intronic
1048228217 8:132611261-132611283 TGAAATTGTAATAGCCTACAGGG + Intronic
1048877059 8:138845017-138845039 TGAAATGGAAATTGTGTGCAGGG + Intronic
1054778591 9:69145494-69145516 TGCAATGGCAGTATTATACAAGG - Intronic
1056231852 9:84554566-84554588 TGCACTGGAAATAGTGCACAGGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057161689 9:92893649-92893671 TGAACTGGAAATAGTCCACAGGG + Intergenic
1057416641 9:94869640-94869662 TGAAATTGAATTAGTGTAAAAGG + Intronic
1058571611 9:106352007-106352029 TAAAATAGCAATAATTTACAAGG - Intergenic
1059977914 9:119737406-119737428 TGAAATGGTCATACTGTATATGG - Intergenic
1060715126 9:125919178-125919200 TGAAATGGGAATAGAGCAGATGG + Intronic
1186301483 X:8204529-8204551 TGAAATGGGAATAGTGAAATAGG - Intergenic
1187586343 X:20666368-20666390 TGAAATGGCAAAAATTTCCAGGG - Intergenic
1188745363 X:33834493-33834515 TAAAATGTCCATACTGTACAAGG - Intergenic
1193588908 X:83363280-83363302 TGAAATGGCCATACTGCCCAAGG - Intergenic
1195636049 X:107117426-107117448 TGAAATGGTAATAGTGAAAATGG + Intronic
1196048686 X:111282392-111282414 TGAAATGGAAATGGTGAACAAGG + Intergenic
1197585246 X:128338865-128338887 TGGGATGTCAATAGTGAACATGG - Intergenic
1198953326 X:142098138-142098160 TGAAATTGAAACAGTGAACAAGG + Intergenic
1199662657 X:150067690-150067712 GAAAATGGCCATAGTGTCCAAGG - Intergenic
1200072247 X:153535038-153535060 TGAAATGGCCTCAGTGCACATGG - Intronic
1200882151 Y:8226164-8226186 TGAAATTGCAAATGTTTACATGG - Intergenic
1201939091 Y:19439570-19439592 TGAAATGGCCATACTGCCCAAGG + Intergenic
1201988623 Y:19998059-19998081 TGAAATTGTAATATTTTACAGGG + Intergenic