ID: 926648397

View in Genome Browser
Species Human (GRCh38)
Location 2:15315030-15315052
Sequence GAGGCTAAGACTTTCTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926648391_926648397 12 Left 926648391 2:15314995-15315017 CCTGTCGGAAGTGTGGGTTGGGC 0: 1
1: 0
2: 0
3: 7
4: 85
Right 926648397 2:15315030-15315052 GAGGCTAAGACTTTCTAGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 84
926648389_926648397 13 Left 926648389 2:15314994-15315016 CCCTGTCGGAAGTGTGGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 111
Right 926648397 2:15315030-15315052 GAGGCTAAGACTTTCTAGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926648397 Original CRISPR GAGGCTAAGACTTTCTAGGG TGG Intronic
901102072 1:6726570-6726592 GATGCTGAGATTTTCCAGGGTGG - Intergenic
902173556 1:14632164-14632186 GGAGCTAAGGCTTTCTGGGGTGG + Intronic
904169128 1:28579090-28579112 GATGCTAAGACTTTCTGGCCCGG + Intergenic
905326587 1:37156788-37156810 GAGGATAAGGCTATCAAGGGTGG - Intergenic
907393197 1:54172017-54172039 GAGGCCAACACATTCTAGGTTGG + Intronic
909333104 1:74438788-74438810 GAGGCTAGAACTTTGTACGGAGG + Intronic
911749595 1:101481176-101481198 GATCCTAAGACTTTGTAGGCTGG - Intergenic
914318836 1:146540058-146540080 GATCCTAAGACTTTATAGGCTGG + Intergenic
914495522 1:148193299-148193321 GATCCTAAGACTTTATAGGCTGG - Intergenic
916749361 1:167710264-167710286 GAGGCTATTATTTTCTTGGGGGG - Intergenic
917246734 1:173011034-173011056 GAGACTAAGTCTTGCTAGTGAGG + Intergenic
917847841 1:179036888-179036910 GAGGCTCAGACTTTATCAGGAGG + Intronic
917971899 1:180213842-180213864 GAAGCTAAGACATTTTGGGGTGG - Intergenic
921297890 1:213721917-213721939 CAGGCTAAGTGTTTCTAGGCAGG - Intergenic
1067214360 10:44289245-44289267 GACTCTAAGACTTTATAGGCTGG + Intergenic
1069238565 10:66109288-66109310 GAGGCTAAGTCTGTCTCTGGAGG - Intronic
1069734876 10:70647511-70647533 GATCCTAGGACTTTCTAGGCTGG + Intergenic
1070160819 10:73865800-73865822 GAGGCTCAGACCTTCCAAGGTGG + Intronic
1083972725 11:66091005-66091027 GAGACTAAGATTTACTGGGGTGG - Intronic
1084858191 11:72002030-72002052 GAGGCTGTGATTTTCTAGGTAGG - Exonic
1085965348 11:81516625-81516647 GAGGCTAAGAAATTCAAGGTTGG + Intergenic
1088702178 11:112423130-112423152 GAGGCTCAGACTTTTGAGGGAGG + Intergenic
1089200330 11:116720818-116720840 GAAGCTCAAGCTTTCTAGGGAGG - Intergenic
1092967141 12:13655108-13655130 GAAGTTAAGACTTAGTAGGGTGG + Intronic
1093262433 12:16955483-16955505 GTGAATAAGACTGTCTAGGGAGG + Intergenic
1093483578 12:19629172-19629194 GAGGCAAAGACTTCTAAGGGTGG + Intronic
1093821504 12:23624644-23624666 CAGGCTTAGACTTTCTGAGGAGG + Intronic
1095558377 12:43535999-43536021 GAGGCTAAGTCATCCAAGGGAGG + Intronic
1097970622 12:65629535-65629557 ATGGCTGAGACTTACTAGGGGGG - Intergenic
1100002096 12:89849597-89849619 TAGGCTAAGCCTTTTTAGGTAGG - Intergenic
1103911782 12:124355959-124355981 GGGGCTAAGACTTTCTCCTGAGG - Intronic
1110166783 13:72452133-72452155 GAGGCTGTGGCTTTGTAGGGAGG - Intergenic
1112361994 13:98726929-98726951 GAGCCTCTGACTTTTTAGGGTGG + Intronic
1113650321 13:112029753-112029775 AAGGCTAGAACTGTCTAGGGGGG + Intergenic
1114835096 14:26194753-26194775 GTGGAAAAGACTTTCTAGGCTGG - Intergenic
1122262098 14:100529519-100529541 GAGGCCAAGCCTTGCTGGGGTGG + Intronic
1129769885 15:78196137-78196159 GAGGTTAAGACCTTCTGGGATGG + Intronic
1135916409 16:26609281-26609303 GAGGCTGAGACTTACTGGGTTGG - Intergenic
1136986105 16:35106629-35106651 GGGGCTAAGAGTTTCTAATGGGG + Intergenic
1139125778 16:64075163-64075185 GATGCTAAGACTTTCTGGTTTGG + Intergenic
1147838471 17:43352712-43352734 GAGGCTGGGACTTTCTGGGCTGG - Intergenic
1156632218 18:38983906-38983928 GAGGCTGGGACTTTTTAGAGTGG - Intergenic
1156743546 18:40361931-40361953 AAGTCTTAGACTCTCTAGGGGGG - Intergenic
1156881233 18:42083016-42083038 GAGGATAAACCTTTCTAGGAAGG + Exonic
1157125965 18:44956195-44956217 GAGGCTAAGGCTTGGAAGGGAGG - Intronic
1158488769 18:57891501-57891523 GGGGCTGAGACATTCTAGTGGGG + Intergenic
1160968306 19:1756156-1756178 GAGGGAATGGCTTTCTAGGGAGG - Intronic
1165078730 19:33295565-33295587 GAGGAGAAGAGTTTCCAGGGAGG + Intergenic
1167277451 19:48546869-48546891 GAGGCCAGGACCTTCTTGGGAGG - Intergenic
926595003 2:14780462-14780484 AGAGCTAAGACTTTCTAGGATGG + Intergenic
926648397 2:15315030-15315052 GAGGCTAAGACTTTCTAGGGTGG + Intronic
935209242 2:100924160-100924182 GAGGCTGAGTGTGTCTAGGGAGG - Intronic
944013588 2:195004458-195004480 AAGCCTATGACTTTCTGGGGAGG - Intergenic
947924694 2:233911159-233911181 GTGGCTTGGACTTCCTAGGGTGG - Intergenic
1174818539 20:53707937-53707959 GTGACTAACATTTTCTAGGGAGG + Intergenic
1176076689 20:63251857-63251879 GAGACTAAGAGTTTCGTGGGCGG - Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1184391240 22:44204770-44204792 GTGGCTAAGACATTGAAGGGAGG + Intronic
1185156704 22:49197381-49197403 GAGGCTGAGGGTTTCTGGGGGGG - Intergenic
950606588 3:14086857-14086879 GAGGCAAAGCCTCTCCAGGGAGG - Intergenic
951301265 3:21000052-21000074 CAGGTAAAAACTTTCTAGGGAGG + Intergenic
952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG + Intronic
952778694 3:37072004-37072026 GAATGTAAGACTTTCTAGGGTGG - Intronic
954080424 3:48210380-48210402 GTGCCTAAGACTTTCTAAGACGG - Intergenic
959342856 3:105152753-105152775 GAGGCTAATACTACCTAGGAAGG + Intergenic
960396374 3:117142396-117142418 AAGACTTAGACTTTCTAGAGGGG - Intergenic
963917454 3:150871909-150871931 GAGGGCAAGGCTTTCTAGTGGGG + Intronic
964879696 3:161409984-161410006 GAGGGAAAGACTTTCTCAGGAGG - Intergenic
969901708 4:10356032-10356054 GATCCTAAGACTTTGTAGGCTGG - Intergenic
970368699 4:15386719-15386741 GAGGGAAAGGCTTTCTAGGCAGG + Intronic
971725390 4:30305281-30305303 GAGGCCAGGACTTTCATGGGTGG - Intergenic
974195582 4:58570371-58570393 AAGGCTCAGACTTTATAGGAAGG + Intergenic
984262831 4:177462367-177462389 AAGGCTAAGGCTTACTAGTGAGG + Intergenic
986454615 5:7903848-7903870 GATGCTAGGACTTTATAGGATGG + Intronic
991314533 5:65285621-65285643 AAGGAAAATACTTTCTAGGGGGG + Intronic
999635815 5:153621162-153621184 GAGGCTAAAGCTTTCTTGAGAGG + Intronic
1000644382 5:163743110-163743132 GAGGCTAAGAGCTCCTAGGTTGG + Intergenic
1001036665 5:168301749-168301771 GGCGCTAAGACTTTCTATGTTGG - Intronic
1008427955 6:51381093-51381115 GAGGCTAAGACTGGCCAGGGTGG - Intergenic
1015006591 6:128289644-128289666 GAGGCTAAGACTTTAAAAGGAGG - Intronic
1039758933 8:40553121-40553143 GAAGCTAACATTTTCCAGGGTGG - Intronic
1040625088 8:49138353-49138375 GAGGATAAGACTTTCTCAGCCGG - Intergenic
1040854302 8:51932812-51932834 GAGTTCAAGTCTTTCTAGGGAGG - Intergenic
1047912534 8:129545998-129546020 GAGGTAGAGACTTTCTGGGGTGG + Intergenic
1053700855 9:40688770-40688792 GAGGTTAAGCCTTTCTACAGTGG + Intergenic
1054312148 9:63488168-63488190 GAGGTTAAGCCTTTCTACAGTGG + Intergenic
1056466594 9:86861827-86861849 GAGGCTGAGAATTTGTAGGGTGG + Intergenic
1188752194 X:33918770-33918792 GATCCTAGGACTTTATAGGGTGG + Intergenic
1192830419 X:74745281-74745303 GAGGCTTAGAACTTCTAGAGTGG - Intronic
1195539777 X:106049801-106049823 AAGGCTAAGGCTTTCTAAAGTGG + Intergenic