ID: 926650749

View in Genome Browser
Species Human (GRCh38)
Location 2:15341629-15341651
Sequence GGGCCTTATGAAGAAACAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926650749 Original CRISPR GGGCCTTATGAAGAAACAGC GGG Intronic
900081678 1:863172-863194 GGCCCTTATGAAGAAAAGGAAGG + Intergenic
900971679 1:5995434-5995456 TGGCCTTCTGAAGGGACAGCCGG - Intronic
900998216 1:6134253-6134275 GGGCCTCCTGCAGACACAGCAGG + Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905402898 1:37716289-37716311 GGCCCTTCTGCAGAAACAGCTGG + Exonic
906407686 1:45554990-45555012 GGGCCTTAAAAAAAAACATCTGG - Intronic
908802631 1:67896434-67896456 GGGCTGTATGAGGAAACAGGAGG - Intergenic
910439897 1:87241184-87241206 GGGCCTTTTGAATATTCAGCTGG - Intergenic
915789915 1:158657478-158657500 GGTGCTGATGAAGAAGCAGCTGG - Exonic
916268736 1:162918230-162918252 GGGCCTTGAGAAAACACAGCCGG - Intergenic
916451388 1:164923907-164923929 CTACCTTATGAAGACACAGCAGG - Intergenic
917538507 1:175891895-175891917 GTGGCTTATGAAGCAACATCGGG - Intergenic
917814083 1:178689982-178690004 AGGCCTGATGCAGGAACAGCTGG - Intergenic
918577857 1:186085378-186085400 AGGCCATATGAAGACAAAGCAGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
921379752 1:214512343-214512365 GGGCCACATGGAGAAGCAGCAGG - Intronic
921441883 1:215197408-215197430 AGGCCATATGAAGACACAGTGGG - Intronic
1062929722 10:1344880-1344902 AGGCCACATGGAGAAACAGCGGG - Intronic
1063201479 10:3788162-3788184 GGGACTGAGGAAGTAACAGCGGG - Intergenic
1067083456 10:43226139-43226161 GGGCCAGAAGAAGAAACAGAGGG + Intronic
1067825895 10:49572652-49572674 GAGCCTTATGAAAGAACATCTGG + Intergenic
1068505044 10:57889652-57889674 AGTCATTATGAAGAAACAGAAGG + Intergenic
1070374868 10:75819745-75819767 GAGCCATGTGGAGAAACAGCTGG - Intronic
1070377537 10:75848466-75848488 AGGCCTGTTGAACAAACAGCAGG - Intronic
1074253366 10:111776405-111776427 GGGCCTCAGGAAGAAAAAGCTGG + Intergenic
1077576259 11:3386340-3386362 GGGACTGATGGAGAAACAGAAGG + Intergenic
1078374973 11:10786011-10786033 GGGCCTTCAGAAGAAAGAGGTGG + Intergenic
1083738062 11:64693079-64693101 GGGCCCGATGCCGAAACAGCGGG + Intronic
1086319847 11:85633646-85633668 GGGACTAATGAAGAAATAGAAGG + Intronic
1087189276 11:95235457-95235479 GGGCCTTAGAAAAAAATAGCAGG - Intergenic
1090959195 11:131540744-131540766 GGGCCTTGTGCAGATTCAGCTGG - Intronic
1091270705 11:134309909-134309931 GGGCATTATGAACATACAGAAGG - Intronic
1092113668 12:5982891-5982913 TGGGTTTATGAAGAAGCAGCTGG - Intronic
1093168259 12:15830117-15830139 GGGCCTTTTACAGAAAGAGCAGG - Intronic
1093796749 12:23321929-23321951 GGGCCAGATGAAGAAGCACCAGG - Intergenic
1094605743 12:31947532-31947554 GGACCTAAGGAAGACACAGCAGG + Intergenic
1096176812 12:49526835-49526857 GGGCATTTTGAAGAAACTGCAGG - Exonic
1098661025 12:73094142-73094164 GCACCTTCTGAAGCAACAGCTGG - Intergenic
1098816594 12:75172835-75172857 GGGGCTTAGAAGGAAACAGCTGG - Intronic
1100476980 12:94943976-94943998 GGGCGTGTTGAAGAAACAGAAGG + Intronic
1101119946 12:101568487-101568509 TTGCCTTATGAAGAAAGGGCTGG - Intronic
1101939977 12:109092732-109092754 GGGCCTTTTGAGGAAGCAGGAGG - Exonic
1103630092 12:122253024-122253046 GGGCCTGAGGAAGAGAGAGCGGG + Intronic
1104655208 12:130569261-130569283 CGGACTCATGAAGAAACATCAGG + Intronic
1105266083 13:18816891-18816913 GCTCCTTATGGAGAAAGAGCGGG - Intergenic
1106223290 13:27765526-27765548 GGTCCTTATGAGAAAGCAGCAGG - Intergenic
1106719246 13:32421752-32421774 CTGCCTTATGAAGGAACAGTTGG + Intronic
1106804494 13:33292320-33292342 GGCCCTCATAAAGAATCAGCAGG + Intronic
1107438250 13:40401186-40401208 GGGCCTTTTGCAGAGACAGATGG - Intergenic
1112109027 13:96274134-96274156 TGGCCTTAATAAGAAAGAGCGGG - Intronic
1113679658 13:112234487-112234509 GGGCCTGATGAAGAAGCTACCGG - Intergenic
1114781039 14:25538446-25538468 GTGTCTTATGAAGAAACGGGGGG - Intergenic
1116474912 14:45328615-45328637 GTGCATAAGGAAGAAACAGCAGG + Intergenic
1120998335 14:90433863-90433885 AGGCCTTGTGAAGACACAGGGGG - Intergenic
1121579814 14:95021098-95021120 AGGCCTTGTGAGGAAACAGCAGG - Intergenic
1122060947 14:99136366-99136388 GGCTCTTGTGAAGCAACAGCAGG - Intergenic
1123010789 14:105348669-105348691 GGGCCTTGTGCCAAAACAGCGGG + Intronic
1124004457 15:25785007-25785029 GCCCCTTATGAAGGAACAGCGGG + Intronic
1124911845 15:33928818-33928840 GTGCCTTTTGAAGACACATCTGG - Intronic
1126143338 15:45455058-45455080 AGGCCTTGTGACGACACAGCGGG - Intergenic
1130672285 15:85923217-85923239 GGGGCCTATGAAGAAGCATCTGG - Intergenic
1131074610 15:89487188-89487210 GGCCCTTATGAAGGAACTGGAGG - Intronic
1135928732 16:26718292-26718314 GGCCATTATTATGAAACAGCTGG + Intergenic
1136714204 16:32263969-32263991 GGGCCGTTTGAAAAAAAAGCAGG + Intergenic
1136814419 16:33204916-33204938 GGGCCGTTTGAAAAAAAAGCAGG + Intronic
1136820895 16:33314996-33315018 GGGCCGTTTGAAAAAAAAGCAGG + Intergenic
1136827458 16:33371535-33371557 GGGCCGTTTGAAAAAAAAGCAGG + Intergenic
1136832524 16:33470306-33470328 GGGCCGTTTGAAAAAAAAGCAGG + Intergenic
1202992995 16_KI270728v1_random:27890-27912 GGGCCGTTTGAAAAAAAAGCAGG + Intergenic
1203055849 16_KI270728v1_random:925800-925822 GGGCCGTTTGAAAAAAAAGCAGG - Intergenic
1144504856 17:15821305-15821327 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1144645916 17:16973295-16973317 GGCCCTTAGGAAGAAACTGAAGG + Intergenic
1145169029 17:20639188-20639210 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1145203591 17:20968627-20968649 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1146984212 17:37198551-37198573 GGGCTTTAGGAAGAAAAATCAGG - Intronic
1148187707 17:45656464-45656486 GGGCCTTAGCATGAAACACCAGG + Intergenic
1149019890 17:51950748-51950770 GGGTCTTGGGAAGAAACAGATGG - Intronic
1153370856 18:4314265-4314287 GGGCATTAAGAAGTAGCAGCTGG - Intronic
1153614809 18:6924567-6924589 GGAACTTAAGAGGAAACAGCCGG + Intergenic
1155851069 18:30774635-30774657 GTGCCTAATGAGGAAACAGGAGG - Intergenic
1157826463 18:50816841-50816863 GGGCCTCATTATAAAACAGCTGG + Intronic
1160435697 18:78850890-78850912 GGCCATTATCAAGAAACAGAAGG + Intergenic
1161587872 19:5115228-5115250 GGGCCTCAGAAAGACACAGCGGG + Intronic
1163104249 19:15114499-15114521 GGGGCTTATAGAGAAACAGCTGG + Exonic
1165022095 19:32933821-32933843 TGGCCTGATGAAGTCACAGCGGG + Intronic
1166168126 19:41006887-41006909 GGCCCCTAGGAAGAAGCAGCAGG - Exonic
1168540002 19:57202338-57202360 GGGCCTCATGGGGATACAGCTGG + Intronic
926123237 2:10256095-10256117 GGGCCAGATGAAGAAAGAGTTGG - Intergenic
926646131 2:15291655-15291677 GGGACTAAAGGAGAAACAGCTGG + Intronic
926650749 2:15341629-15341651 GGGCCTTATGAAGAAACAGCGGG + Intronic
926800197 2:16653283-16653305 TGGCCAGATGAAGAAACTGCAGG - Intronic
929444214 2:41990112-41990134 GGGCCAGAAGGAGAAACAGCGGG + Intergenic
930588002 2:53292859-53292881 AGGCCTGAAGAGGAAACAGCTGG - Intergenic
930901055 2:56508179-56508201 AGGCCTGATAAAGCAACAGCTGG - Intergenic
935628072 2:105187497-105187519 AGGGCTTGTGAAGAAACTGCAGG + Intergenic
938930176 2:136079871-136079893 AGGCCATGTGAAGACACAGCAGG - Intergenic
938959887 2:136331460-136331482 TGCCCTTGTGAAGAAACAGGAGG - Intergenic
939966544 2:148615885-148615907 GGACATTTTGAAGAAGCAGCAGG - Intergenic
943248552 2:185486867-185486889 GAGACTTATGAGGAAACAACAGG + Intergenic
947781583 2:232770171-232770193 GGGCCGTATGAAGAATGATCTGG - Intronic
948199688 2:236120600-236120622 GGGCCTTACGGAGAGACAGCCGG + Intronic
948286025 2:236786008-236786030 GCGCCTTAGGCAGACACAGCTGG + Intergenic
1170658055 20:18309058-18309080 GGGCCATGTGAAGACACAGGGGG - Intronic
1170895933 20:20414321-20414343 GGGGCCTTTGAGGAAACAGCAGG - Intronic
1170937523 20:20823031-20823053 GAGCCTTCTGAAGGCACAGCTGG - Intergenic
1171159172 20:22906140-22906162 GGGACTTCTGAAGAACCAGGTGG - Intergenic
1171887131 20:30663187-30663209 GCTCCTTATGGAGAAAGAGCAGG - Intergenic
1172788896 20:37488733-37488755 AGGACACATGAAGAAACAGCAGG - Intergenic
1173639405 20:44589987-44590009 TGACCTTATGAAGAAAAGGCAGG + Intronic
1173835459 20:46122516-46122538 GGGTCTGAGGAAGAAAGAGCAGG + Intronic
1174577675 20:51548157-51548179 GGGCGTTATCAAGGAACAGGCGG - Intronic
1176851150 21:13915354-13915376 GCTCCTTATGGAGAAAGAGCGGG - Intergenic
1177723790 21:24941728-24941750 GGGCCATAGGCAGAAACACCAGG + Intergenic
950136274 3:10583409-10583431 GTGCCTTATAAAGGAAAAGCTGG + Intronic
950279939 3:11698194-11698216 TTACCCTATGAAGAAACAGCTGG + Intronic
952286913 3:31978485-31978507 GGGTCTTATGAAGGGACAGATGG - Intronic
956655483 3:71546442-71546464 GGACCTTATGAAGAACCACATGG - Intronic
958446946 3:94227153-94227175 GAGCCATATGCGGAAACAGCAGG + Intergenic
959174292 3:102886304-102886326 GGGTCTTATGAAAAAACATTTGG + Intergenic
960637460 3:119797314-119797336 TGGCCTCATGAGGAAGCAGCAGG + Intronic
961593153 3:127995931-127995953 GGGCCATCTGAACAAACAACAGG - Intergenic
962693780 3:137927598-137927620 GGCAGTTAGGAAGAAACAGCAGG + Intergenic
963558741 3:146832986-146833008 GGGGCTGAGGAAGAGACAGCAGG - Intergenic
963934119 3:151034949-151034971 GGGTATTATGAAGAAAGAACTGG - Intergenic
970053173 4:11939373-11939395 AGGCCCTGTGAAGACACAGCAGG + Intergenic
970451252 4:16168490-16168512 AGGCCTGATGGAGGAACAGCAGG - Intronic
971185647 4:24373199-24373221 GGACCTAATGAGGAAACAGTCGG + Intergenic
972245370 4:37241510-37241532 TGGTCTCATGAAGAAAGAGCAGG + Intergenic
973370489 4:49242876-49242898 GCTCCTTATGGAGAAAGAGCAGG - Intergenic
979866943 4:125768021-125768043 GTGCCTTATCAAGTAACATCAGG - Intergenic
981938522 4:150257983-150258005 GAACCTTATGAAGCAGCAGCAGG + Intergenic
982071882 4:151702790-151702812 AGGGCTTATGTAGAAAAAGCAGG + Intronic
982544258 4:156712744-156712766 GGCCCTAATAAAGATACAGCAGG - Intergenic
985067728 4:186139490-186139512 TGGCCATGTGAAGACACAGCTGG + Intronic
986433941 5:7709521-7709543 GGCCCTTATGAACAACCATCAGG + Intronic
989522687 5:42420429-42420451 TGGCCTGCTTAAGAAACAGCAGG + Intergenic
992410277 5:76498753-76498775 GGGCCTTAAGGAGATACACCAGG - Intronic
993751160 5:91670202-91670224 GGGTCATATGAAGGAGCAGCAGG + Intergenic
999551353 5:152690601-152690623 GGGCCTTCTCAAGTAACAGAAGG - Intergenic
1001602752 5:172939692-172939714 GGGCCTTCAGAAGAACCACCAGG - Intronic
1003972229 6:11310663-11310685 GGGCCTAGTCTAGAAACAGCAGG + Intronic
1004371810 6:15059338-15059360 CTGCCATATGAAGACACAGCAGG - Intergenic
1005418595 6:25626919-25626941 GGGCCACATGGAGAAGCAGCAGG + Intergenic
1007209160 6:40177845-40177867 GGGAATTACAAAGAAACAGCTGG + Intergenic
1007349347 6:41257497-41257519 GGGCCTTGAGAAAAAGCAGCTGG + Intergenic
1008892955 6:56517148-56517170 GGGACTCTTGAAAAAACAGCAGG - Intronic
1013826485 6:114216943-114216965 GAGCTTTATGAAAAAGCAGCTGG - Intronic
1015312604 6:131781977-131781999 TGACCTTTTGAAGCAACAGCAGG - Intergenic
1016319261 6:142824536-142824558 GGACCTTACGAACACACAGCTGG - Intronic
1018788680 6:167129399-167129421 GGGCATTATGAAGCAAGTGCAGG - Intronic
1019192589 6:170261844-170261866 GGACCTCATGGAGAATCAGCAGG + Intergenic
1021409389 7:20312672-20312694 GGACCTGAAGAATAAACAGCCGG + Intergenic
1028755212 7:94426405-94426427 GGGCCCTATAAAGAAACAGAAGG - Exonic
1029649380 7:101880421-101880443 CGGCCTCATAAAGAAACAGATGG + Intronic
1030158898 7:106486866-106486888 AAGCCTTATGAACAAACAGCAGG - Intergenic
1031658872 7:124395811-124395833 GTGGCTTATGAAGAAAAAGAAGG - Intergenic
1035523592 8:294378-294400 GGCCCTTATGAAGAAAAGGAAGG - Intergenic
1036126723 8:6069794-6069816 GGGCCATATGAGGACACAGCTGG - Intergenic
1038209483 8:25502613-25502635 GGTCCGGATGAAGAAACAGGAGG - Intronic
1039714783 8:40095671-40095693 GTGTCTTATCAAGAATCAGCTGG + Intergenic
1042228713 8:66536002-66536024 GGCCCTTATGAAGAAGCCACAGG + Intergenic
1042648245 8:71010918-71010940 GGGACTGCTGAAAAAACAGCAGG + Intergenic
1042895200 8:73659056-73659078 GAGCATTAAGGAGAAACAGCTGG + Intronic
1046059772 8:109124379-109124401 TGGCCTCATGAAGAAGCATCTGG + Intergenic
1047349070 8:124056030-124056052 GGTCCTTATGAGGCAGCAGCAGG - Intronic
1050565720 9:6880674-6880696 GGCCCTAAAGAAGAAGCAGCAGG - Intronic
1052320898 9:27166075-27166097 GGACCTTGTGATGAACCAGCTGG - Intronic
1053146034 9:35712781-35712803 GGGCCTTATGAAGGAACCTGGGG + Intronic
1057402871 9:94740071-94740093 GGGCCATATGAGGAAGCACCGGG + Intronic
1059967540 9:119630441-119630463 GAGCCTAATGAACAAATAGCTGG + Intergenic
1060208136 9:121694543-121694565 GGACCTTCTGGAGAAGCAGCAGG + Intronic
1061679076 9:132233828-132233850 GAGGCTTAGGAAGAAGCAGCTGG + Intronic
1061817916 9:133207382-133207404 GGGCCACATGAAGAAACACTCGG + Intronic
1188620965 X:32223237-32223259 CTGCCTTGTGAAGATACAGCAGG - Intronic
1192174388 X:68876790-68876812 GGGCCTTGTGGAGCTACAGCAGG - Intergenic
1198495816 X:137191976-137191998 GAGCCTTTTGGAGAAATAGCTGG + Intergenic
1198523017 X:137471846-137471868 AGGCCTCATGATGAGACAGCAGG + Intergenic
1199711815 X:150474858-150474880 AGGCCATAAGAAGAAACAGAAGG - Intronic
1201611423 Y:15847031-15847053 GTGCATTATGATTAAACAGCAGG + Intergenic