ID: 926654556

View in Genome Browser
Species Human (GRCh38)
Location 2:15387095-15387117
Sequence TCTGAAGGAGTCGCCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2047
Summary {0: 1, 1: 0, 2: 3, 3: 84, 4: 1959}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926654556 Original CRISPR TCTGAAGGAGTCGCCCAGGC TGG Intronic
Too many off-targets to display for this crispr