ID: 926657588

View in Genome Browser
Species Human (GRCh38)
Location 2:15425722-15425744
Sequence CAGATGTAAGAGATGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926657588_926657590 -1 Left 926657588 2:15425722-15425744 CCTCCTGGCATCTCTTACATCTG 0: 1
1: 0
2: 4
3: 12
4: 209
Right 926657590 2:15425744-15425766 GCTCTATTTTTGCAAGAAAAAGG 0: 1
1: 0
2: 1
3: 24
4: 269
926657588_926657592 1 Left 926657588 2:15425722-15425744 CCTCCTGGCATCTCTTACATCTG 0: 1
1: 0
2: 4
3: 12
4: 209
Right 926657592 2:15425746-15425768 TCTATTTTTGCAAGAAAAAGGGG 0: 1
1: 0
2: 2
3: 55
4: 578
926657588_926657591 0 Left 926657588 2:15425722-15425744 CCTCCTGGCATCTCTTACATCTG 0: 1
1: 0
2: 4
3: 12
4: 209
Right 926657591 2:15425745-15425767 CTCTATTTTTGCAAGAAAAAGGG 0: 1
1: 0
2: 4
3: 56
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926657588 Original CRISPR CAGATGTAAGAGATGCCAGG AGG (reversed) Intronic
903535869 1:24065937-24065959 CAGAGGGCAGAGATGCCAGATGG - Exonic
904000171 1:27334381-27334403 CAGTTGGAACAGATGCCAGTTGG + Intronic
906259886 1:44378873-44378895 CAGATGAAGGAGCTGCAAGGAGG - Intergenic
906455470 1:45993257-45993279 CAGAAGCAAAGGATGCCAGGTGG - Intronic
907652757 1:56311437-56311459 CAGATTTAAGTGATGGCAAGAGG - Intergenic
907978849 1:59460656-59460678 CAGCTGTATGAGATGTCAGTCGG - Intronic
910238068 1:85056294-85056316 AAGATGAAAAAGATGGCAGGAGG + Intronic
913051057 1:115116695-115116717 CACTTCTAAGAGCTGCCAGGTGG - Intergenic
916923019 1:169488283-169488305 CAGATGTGAGATTTTCCAGGTGG + Intergenic
917182232 1:172311492-172311514 CAGCTACAAGGGATGCCAGGAGG + Intronic
917512194 1:175677913-175677935 GAGAGGAAAGAGAAGCCAGGGGG + Intronic
917601165 1:176575398-176575420 CAGAGGTAAGACATGGCAGATGG - Intronic
918094660 1:181324920-181324942 CAGATGCAGGAGATGGAAGGAGG - Intergenic
918320954 1:183364386-183364408 CAGATGAAAGAGTTGCCAATGGG - Intronic
921716274 1:218420011-218420033 CATATGTTATAGGTGCCAGGAGG + Intronic
923929502 1:238677864-238677886 CACATGTAAGAGATAACACGTGG - Intergenic
1065276174 10:24088158-24088180 GAGAAGTCAGAGATGCCTGGAGG + Intronic
1067067114 10:43110486-43110508 CAGCTGCAAGAGTTGCCAAGAGG + Intronic
1067544218 10:47181262-47181284 CAGAAGCAAAACATGCCAGGGGG - Intergenic
1068131706 10:52903073-52903095 GAGATGTAAGACATGGAAGGTGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069886850 10:71629233-71629255 CAGATGCAAATGATGTCAGGTGG + Intronic
1071009488 10:80920890-80920912 TAGAAGTGAGAGAAGCCAGGAGG + Intergenic
1072214005 10:93272863-93272885 TTGAAGCAAGAGATGCCAGGAGG + Intergenic
1075760083 10:124849050-124849072 CAGCTGTAAGAGGAGGCAGGAGG - Intergenic
1075946592 10:126438797-126438819 CACTTTTAAGAGATGCCATGTGG - Intronic
1077710538 11:4532155-4532177 CAGCTGTATGAGATGTCAGTTGG - Intergenic
1077741836 11:4854821-4854843 CAGCTGTAAGAGGTGTCAGTTGG - Intronic
1077806656 11:5596849-5596871 CAGATGTAAGCAATATCAGGTGG - Exonic
1078375752 11:10791914-10791936 AAGATCTAAGAGATGCCAGGGGG - Intergenic
1078469602 11:11576423-11576445 CAGATATAAGAGAGGACAGTGGG + Intronic
1079394670 11:20051346-20051368 CAGATGGCACAGATGCAAGGAGG - Intronic
1080973950 11:37312544-37312566 CAGATGTAAGAGATTATGGGGGG - Intergenic
1081595088 11:44453462-44453484 CAGATGCCAGAGAGGCCTGGGGG + Intergenic
1084020301 11:66413362-66413384 CAGCTGGAAGAGAGGCAAGGGGG + Intergenic
1086964422 11:93012881-93012903 CAGCTGTAACAGATGGGAGGAGG - Intergenic
1088668632 11:112119636-112119658 GAGATGAAAAAGATACCAGGAGG + Intronic
1089651828 11:119919653-119919675 CAGATGTGAGAGAGCCCTGGAGG - Intergenic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1090493850 11:127190882-127190904 CAGATGGAAGAGATGCATAGGGG + Intergenic
1091275257 11:134345371-134345393 CTGAAGCATGAGATGCCAGGAGG - Intronic
1093400774 12:18744048-18744070 CTGATGGAATAGAAGCCAGGGGG - Intergenic
1093428192 12:19053155-19053177 CAAATGTAAGAAATGACAGAGGG + Intergenic
1093977867 12:25442316-25442338 CTGAAGTAATAGAGGCCAGGTGG - Intronic
1094608882 12:31974106-31974128 CAGGTGGAAGAGATGCATGGGGG + Intronic
1094625406 12:32118978-32119000 CAGTTGTGAGAGGTGCCATGAGG + Intronic
1096541262 12:52308567-52308589 CAGCTGTAAGAGGTGCTAGGAGG + Exonic
1098625609 12:72662123-72662145 CACATGGAAGATATGCCAGGAGG - Intronic
1101198447 12:102409565-102409587 CACTTGTATGAGATGGCAGGGGG - Intronic
1101204784 12:102475758-102475780 CAGGTAGAAGAGATGCGAGGAGG + Exonic
1101470119 12:104987964-104987986 CAGATGTAAGAAAGGAGAGGTGG + Intronic
1102382884 12:112482727-112482749 TAGATGTGAGAGGTGCCGGGGGG + Intronic
1108418463 13:50224942-50224964 CAGAAATGAGAGATGCCAGACGG + Intronic
1109651690 13:65336250-65336272 CAGATGTATGAGCTGCCAGGGGG + Intergenic
1109933401 13:69246140-69246162 TAGATGTGAAAGATGCAAGGTGG - Intergenic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1112439139 13:99412975-99412997 GGGATGCTAGAGATGCCAGGTGG + Intergenic
1113123434 13:106949476-106949498 CAGTTGTAACAGACACCAGGGGG - Intergenic
1115200860 14:30852895-30852917 CAGGTGTAGCAGATGCCACGTGG + Intergenic
1116634508 14:47377968-47377990 CAGCTGTATGAGATGTCAGTTGG - Intronic
1119209131 14:72816810-72816832 CAGAAATAAAAGATGACAGGAGG - Intronic
1119922588 14:78460127-78460149 CAGATGAAAGAGATGCAGAGTGG + Intronic
1121518180 14:94567838-94567860 CAGATGTAAGCCTCGCCAGGTGG - Intronic
1121638048 14:95466907-95466929 CAGATGTCACAGATGTCAGTGGG - Intronic
1124869962 15:33530797-33530819 CATATGTAGGAAATGCCAAGAGG - Intronic
1125205675 15:37151368-37151390 CAGAAGTAAGAGAGGCCAGGTGG + Intergenic
1125551007 15:40544516-40544538 CCCATATAATAGATGCCAGGGGG - Intronic
1126362100 15:47857305-47857327 CAGAGGTAAGAGACTCCATGGGG + Intergenic
1127569805 15:60230896-60230918 CAAATGGAAGAGATGCATGGGGG - Intergenic
1129532940 15:76283542-76283564 CAAAGGTAAGAGATACTAGGAGG + Intronic
1129999115 15:80032109-80032131 CAGGTGCAGGAGATGCAAGGAGG + Intergenic
1132092169 15:98955716-98955738 CTGATGTAAGAGAAGCCACTGGG - Intronic
1132294575 15:100725963-100725985 CAGAAGGAAGAGAAGCCAGGAGG + Intergenic
1132787658 16:1666909-1666931 CAGATGAAAGAGATGCTCAGTGG - Intronic
1133570026 16:7031997-7032019 CAGATGTGAGCAAAGCCAGGAGG - Intronic
1138104495 16:54280473-54280495 CAAGTGAAAGAGATGCCAAGAGG + Intergenic
1138807202 16:60104259-60104281 TAGATGTATGAGATGGTAGGAGG - Intergenic
1140022366 16:71250704-71250726 CAGATAGATGAGATTCCAGGAGG - Intergenic
1141030681 16:80585289-80585311 CTGATGTAATAGATGACAGGTGG - Intergenic
1141868030 16:86764206-86764228 CATCTCTAAAAGATGCCAGGTGG + Intergenic
1142031937 16:87842876-87842898 CAGATGGGAGAGAGGCCAGAGGG - Intronic
1144329218 17:14209226-14209248 GAGATGTCAGAGAAGCCAGAAGG - Intergenic
1144370222 17:14583485-14583507 GAGATGAAAGAGATTCCAGGAGG + Intergenic
1146680243 17:34802056-34802078 AAGATGTAAAAGATGCAGGGTGG - Intergenic
1147362710 17:39941715-39941737 CAGAGGTAAGAGCTGCTAGCAGG + Intronic
1147401757 17:40184441-40184463 TGGAAGGAAGAGATGCCAGGGGG + Intronic
1148775740 17:50095002-50095024 CAGGTGAAGGAGATGCGAGGGGG + Intronic
1150643018 17:66962447-66962469 TAGATGGCAGAGATGACAGGTGG - Intergenic
1151003195 17:70402004-70402026 CAGATGAAACAAATGCCAGATGG - Intergenic
1151279127 17:73058795-73058817 CAGATGAAAGAGAACTCAGGAGG + Intronic
1153299362 18:3579692-3579714 CAGATGTAAAAGAAACAAGGTGG + Intronic
1153366626 18:4264575-4264597 CAGGAGTTAGAGAAGCCAGGTGG - Intronic
1155332915 18:24736286-24736308 CAGATGTAAGGGCTGCCCAGAGG + Intergenic
1157012238 18:43664508-43664530 CAAATGTAGCATATGCCAGGGGG + Intergenic
1157620729 18:49016303-49016325 AATATTTAAGAGATGGCAGGAGG + Intergenic
1158112099 18:53951734-53951756 CAGCTGTCTGGGATGCCAGGTGG - Intergenic
1159591472 18:70339616-70339638 CTGATGGAAGAGAAGCCAGAAGG + Intronic
1160131294 18:76227147-76227169 ATGATTTCAGAGATGCCAGGAGG + Intergenic
1161650075 19:5478874-5478896 CAGATGTAAGAGTTTCAAGCAGG + Intergenic
1162395737 19:10417278-10417300 CAGATGTGAGGGATGGGAGGGGG + Intronic
1162584005 19:11547930-11547952 CAGAGGTCATAGAGGCCAGGAGG + Intronic
1164998122 19:32738411-32738433 CAGAGGAAAGAGATGCCAGGAGG - Intronic
925080443 2:1059216-1059238 CAGCTCTAAGAGATGGCAGAAGG - Intronic
926476167 2:13325716-13325738 TAGAGATAATAGATGCCAGGTGG + Intergenic
926657588 2:15425722-15425744 CAGATGTAAGAGATGCCAGGAGG - Intronic
926938987 2:18115406-18115428 CAGCTGTGAGAGCAGCCAGGAGG + Intronic
927272108 2:21222758-21222780 GAGATGTCAGAGATCACAGGGGG + Intergenic
927273733 2:21242600-21242622 CAGATATAAGATAGGCAAGGGGG + Intergenic
927476244 2:23416505-23416527 CAAATGTAAGAGATGCTATGTGG + Intronic
927863839 2:26576489-26576511 CAGATCCAAGAGACTCCAGGGGG - Intronic
930696555 2:54417226-54417248 CAGAAGTAGGAGGGGCCAGGAGG + Intergenic
931951960 2:67374015-67374037 CAGGAATCAGAGATGCCAGGTGG - Intergenic
932433422 2:71688852-71688874 GAGAAGGAAGAGAGGCCAGGTGG + Intergenic
935932735 2:108146387-108146409 CAGATGTATGAAATGAGAGGTGG - Intergenic
936925096 2:117728869-117728891 CAGATGTATGAGATGTGAGTTGG - Intergenic
939551220 2:143618344-143618366 CAAATGGAAGAGATGCCAGAGGG - Intronic
939730893 2:145783116-145783138 CAGCTGTATGAGATGTCAGTCGG - Intergenic
940214195 2:151288033-151288055 CAGATGCAAAAGATGCCAAAAGG - Intronic
940907637 2:159183504-159183526 CGGATGTAAGTGTTGCCAAGAGG + Intronic
942309442 2:174641579-174641601 CATTTGTAAGATATGCCAGTGGG - Intronic
945060736 2:205906624-205906646 CATAGGTAAGTTATGCCAGGAGG - Intergenic
946026566 2:216675247-216675269 CTGAAGTAAGAGATGGCAGAGGG - Exonic
946647111 2:221849471-221849493 CAGCTGCAAAAGGTGCCAGGTGG + Intergenic
948117933 2:235507448-235507470 CAGCTGTCAGAGATGCCTGCAGG - Intronic
1170311361 20:14996334-14996356 CAGATGTAACAGATTCCTGGAGG - Intronic
1170526608 20:17244793-17244815 AAGATGTCACAGGTGCCAGGAGG + Intronic
1171491546 20:25522539-25522561 CAGATGCTAGGGATGCAAGGAGG - Intronic
1171782701 20:29435503-29435525 CAGAGGTTAGAGATGGCAGAAGG + Intergenic
1172034811 20:32003189-32003211 CAGATGTAGTAAATACCAGGAGG - Exonic
1173268032 20:41504758-41504780 CAGATATTAGAGTTGGCAGGAGG - Intronic
1173646308 20:44635230-44635252 CAGCTCTCAGAGATGCTAGGGGG - Intronic
1174246108 20:49182002-49182024 CAGATTAAACAGATGCCAGATGG + Intronic
1174553961 20:51380906-51380928 CTAATGGAAGAGATGCCAGGTGG + Intergenic
1177960090 21:27653430-27653452 GAGAAGGAAGAGAAGCCAGGAGG + Intergenic
1178292662 21:31382524-31382546 CAGATCAAAGAGTTGTCAGGAGG - Intronic
1178639959 21:34337728-34337750 AAGCTGTAAGAGAAGCCAGCAGG - Intergenic
1178884144 21:36472202-36472224 TTCAGGTAAGAGATGCCAGGAGG + Intronic
1179287223 21:39988004-39988026 CAGATGTCAGGGATGCCCTGTGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1184199738 22:42959860-42959882 CAGAGGTCAGACATGCCAGCAGG - Intronic
951613303 3:24516532-24516554 CAGATTTGAGAGATGTCAGAAGG - Intergenic
952141203 3:30480766-30480788 CAGCTGTAAAAGCAGCCAGGAGG + Intergenic
952283038 3:31941679-31941701 GAGATGTGAAAGATGGCAGGTGG - Intronic
956727930 3:72171906-72171928 CAGGTGTAAGAGCTACCAGAGGG + Intergenic
956796320 3:72721991-72722013 AAGTTGTAAGATGTGCCAGGAGG - Intergenic
957512737 3:81210626-81210648 CTGATGTGAGATATGCCAGAGGG + Intergenic
958052978 3:88371865-88371887 CAGAAATAATAGAGGCCAGGAGG + Intergenic
960697177 3:120407565-120407587 TTGATGTAAGAAATGCCAGCTGG + Intronic
961985290 3:131125555-131125577 CAACTGTAAGAGATGGCAGAAGG - Intronic
962385583 3:134929834-134929856 CAGGTGTTTGAGAAGCCAGGAGG + Intronic
964472071 3:157066658-157066680 CAAATGTGAGAGCAGCCAGGTGG + Intergenic
966129749 3:176624012-176624034 CAAATGTAAGAGAAGCTAGGAGG - Intergenic
968500254 4:946626-946648 AAGATGAATAAGATGCCAGGTGG - Intronic
971114643 4:23630548-23630570 CAGGAGTAAGAGAAACCAGGAGG + Intergenic
972803208 4:42499426-42499448 CACATAAAAGAGATGCCAGAAGG + Intronic
973865371 4:55107682-55107704 CAGCTGTAAGAAATGCAAGATGG + Intronic
975298555 4:72763335-72763357 CAAATGCAAGAGATGAAAGGGGG - Intergenic
975844644 4:78511920-78511942 CAGGTGCCAGAGAAGCCAGGAGG - Intronic
975922374 4:79407589-79407611 CAGATGTAACAAATGCAAGTAGG - Exonic
979327232 4:119394346-119394368 CAGATGTAACAAATGCAAGTAGG - Intergenic
979736601 4:124093486-124093508 CAGATCAAAGAGATGCCATTAGG - Intergenic
980354624 4:131725233-131725255 CAGCAGTAAGAAACGCCAGGAGG + Intergenic
981564432 4:146083755-146083777 TAGATATCAGAGATCCCAGGAGG + Intergenic
981585059 4:146291695-146291717 CAGCAGTTAGAGATGCCAAGAGG - Intronic
983228743 4:165109124-165109146 CAGATGTAAGAGAGTTCAGTAGG - Intronic
983245115 4:165279034-165279056 CAGATGTAACAAATGCAAGTAGG - Intronic
986267712 5:6204662-6204684 CAGAGGTAAAATATGCCAGAAGG + Intergenic
988426801 5:31074039-31074061 CAGCTGTGAAAGAAGCCAGGAGG - Intergenic
990585539 5:57207707-57207729 CAGATGGATGGGAAGCCAGGAGG + Intronic
990991323 5:61686842-61686864 CATATGAAAGAGAAGCCAAGGGG - Intronic
993503068 5:88683626-88683648 CAGGTGTAATGGATGGCAGGGGG + Intergenic
995646795 5:114321601-114321623 CTGATGTAAGAGATGGCAAGAGG - Intergenic
995705497 5:114985046-114985068 CTGATGGTAGAGAAGCCAGGTGG - Intergenic
997060554 5:130496525-130496547 CAGATGTAGTAGACACCAGGAGG - Intergenic
998819840 5:146048628-146048650 CTGATGTCTGAGATGCCTGGAGG + Intronic
1001477940 5:172064365-172064387 CAGACTTAAAAGATGCCAAGTGG + Intronic
1004017769 6:11747839-11747861 CAGATGAAAGAGAGGCCATCAGG - Intronic
1005597203 6:27390532-27390554 CATATTTCAGAGATGCTAGGAGG - Intronic
1009290471 6:61874825-61874847 CAGTTTTAAGAAATACCAGGAGG - Intronic
1011531197 6:88322754-88322776 CAGATGTCAGAGATGACACCAGG - Intergenic
1020349353 7:7201386-7201408 CAGCTGTATGAGGTGCCAGTCGG + Intronic
1020435358 7:8156674-8156696 CAGAAGTAAGAGAGGAAAGGAGG + Intronic
1028310776 7:89332332-89332354 CATATGGAAGAGATACCAGTTGG + Intronic
1030653828 7:112144494-112144516 CAAATGTAGGAAATGCCAAGTGG - Intronic
1030873434 7:114785226-114785248 CAGAAGCAGGAAATGCCAGGTGG - Intergenic
1033433804 7:141314084-141314106 TAAATGAAAGAGATGTCAGGTGG - Intronic
1033584623 7:142764907-142764929 CAGGTGCCAGAGGTGCCAGGGGG - Intergenic
1034208906 7:149345220-149345242 CAGCTGTATGAGATGTCAGTTGG + Intergenic
1035361492 7:158316579-158316601 CTGAGGGAGGAGATGCCAGGAGG - Intronic
1035449106 7:158963951-158963973 CAGGTGGAAGAGGGGCCAGGTGG - Intergenic
1035635420 8:1140316-1140338 CAGATGGAAGGGAGGCCAGAGGG - Intergenic
1035765908 8:2105268-2105290 CAGATGCAAGGAAAGCCAGGTGG - Intronic
1037557584 8:20040708-20040730 CAGGTGTATGAGATGTCAGTTGG + Intergenic
1037590491 8:20308003-20308025 CAGAGATAAGAGATTCAAGGTGG - Intergenic
1043119713 8:76308099-76308121 CATAAGAAAGAAATGCCAGGAGG + Intergenic
1045042545 8:98240330-98240352 CTGATGTAAGAAAAACCAGGAGG + Intronic
1045060941 8:98410363-98410385 CACATGTTAGTGATGCCTGGGGG - Intronic
1047200577 8:122761751-122761773 CAGAAGTAACAGAGGCCAAGTGG + Intergenic
1048308734 8:133301839-133301861 CAGGTGTGCAAGATGCCAGGAGG - Intronic
1048824718 8:138412828-138412850 CTGATGCAAGTGTTGCCAGGTGG - Intronic
1048977096 8:139679202-139679224 CCTATGGAAGTGATGCCAGGTGG + Intronic
1050888533 9:10794969-10794991 CAGTTCTAAGAGATGCCTTGTGG + Intergenic
1051960532 9:22756561-22756583 CAGATGGAAGAGATGGAAAGAGG - Intergenic
1052805992 9:33013871-33013893 GAGATGAAAGAAATGACAGGTGG + Intronic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1056325578 9:85475564-85475586 CAGCTGTAAAAGCAGCCAGGAGG + Intergenic
1056700946 9:88907681-88907703 CAGCTGTATGAGATGTCAGTAGG - Intergenic
1058014010 9:100009485-100009507 AAGATGAATGTGATGCCAGGGGG - Intronic
1060326849 9:122625047-122625069 CAGATGCAAGAGATTTTAGGAGG + Intergenic
1187503524 X:19859785-19859807 CAGATGGTTGAGAGGCCAGGAGG - Intronic
1188487258 X:30696079-30696101 CAGATGTAACAAATGCAAGTAGG + Exonic
1189526224 X:41824803-41824825 CAGATCTTAGTGCTGCCAGGAGG + Intronic
1190223533 X:48528642-48528664 CAGATACAAGAGAAGCCAGGAGG + Exonic
1190915994 X:54811525-54811547 CTGACTGAAGAGATGCCAGGTGG - Intronic
1191796335 X:65025730-65025752 CTGAAGTAAGAGATCCCTGGGGG - Intronic
1192188574 X:68976036-68976058 CAGAAGTAATAGAAGCCAGAAGG - Intergenic
1192708428 X:73553167-73553189 CAGAAGTAATTGAGGCCAGGAGG + Intergenic
1193901394 X:87182550-87182572 GAGAAGTAAGGGATGCCAGTGGG + Intergenic
1195123347 X:101779929-101779951 CAGATGTAACAAATGCAAGTAGG - Intergenic
1196020492 X:110985940-110985962 GAGATTGAAGAGAAGCCAGGGGG - Intronic
1196222249 X:113125164-113125186 GAGAGTTAAGAGATGCCAGTAGG - Intergenic
1198833173 X:140772916-140772938 TAGGTTTAAGAAATGCCAGGTGG + Intergenic
1199449965 X:147968152-147968174 CAGCTGTATGAGATGTCAGTCGG - Intergenic
1200252151 X:154559468-154559490 CAGATGGATCAGCTGCCAGGGGG + Intronic
1200265617 X:154644948-154644970 CAGATGGATCAGCTGCCAGGGGG - Intergenic
1201504539 Y:14683135-14683157 CAAATGTCATAGATGGCAGGTGG + Intronic