ID: 926659705

View in Genome Browser
Species Human (GRCh38)
Location 2:15450993-15451015
Sequence TGGGACTGTTTGGGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 409}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926659699_926659705 15 Left 926659699 2:15450955-15450977 CCATAAAACTATGAAACTATACC 0: 1
1: 0
2: 0
3: 9
4: 216
Right 926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG 0: 1
1: 0
2: 1
3: 27
4: 409
926659698_926659705 28 Left 926659698 2:15450942-15450964 CCTTCTGGAATATCCATAAAACT 0: 1
1: 0
2: 0
3: 24
4: 161
Right 926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG 0: 1
1: 0
2: 1
3: 27
4: 409
926659702_926659705 -6 Left 926659702 2:15450976-15450998 CCAACAGTAATTGATTCTGGGAC 0: 1
1: 0
2: 1
3: 12
4: 99
Right 926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG 0: 1
1: 0
2: 1
3: 27
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926659705 Original CRISPR TGGGACTGTTTGGGAGAAAA AGG Intronic
902123055 1:14184236-14184258 TGGGTCGGGTGGGGAGAAAAAGG - Intergenic
902785603 1:18730870-18730892 TGGGACTGATTTGGAGTAGAGGG + Intronic
903169481 1:21543297-21543319 AGGGAGTGTTGGGGAAAAAAAGG - Intronic
903780010 1:25815009-25815031 TGGGCCTGGTTGGGAGAACCAGG + Intronic
905047212 1:35015255-35015277 AGGTACTGTATGGTAGAAAAAGG + Intronic
905265240 1:36748834-36748856 TAGGAGTGGTTGGCAGAAAATGG - Intergenic
906964798 1:50445705-50445727 TGGGACTCCTTGGGGGAGAAGGG + Intronic
907375436 1:54034270-54034292 TGCTGCTGCTTGGGAGAAAATGG + Intronic
907794646 1:57703544-57703566 TGGGAAAGTTGTGGAGAAAAAGG + Intronic
908864821 1:68535711-68535733 TGGCAAGGTTGGGGAGAAAAGGG + Intergenic
910010514 1:82455551-82455573 TGTGAGTGTTTAGGAGAAACTGG - Intergenic
911066110 1:93790015-93790037 AGGGAGTGTGTGGGACAAAATGG + Intronic
911138016 1:94463642-94463664 TTGGACTGTTTGGAAGGACAGGG - Intronic
911208398 1:95116059-95116081 TGAGAGTCTTGGGGAGAAAAAGG + Intergenic
912300053 1:108505668-108505690 GATGACTGATTGGGAGAAAAGGG - Intergenic
913236007 1:116784102-116784124 TGTGACTGGTTGGGAGCAAGGGG + Intergenic
915001712 1:152600316-152600338 TGGGAGTGTTTGGGAAAGAGAGG + Intronic
915471157 1:156126543-156126565 TGGGGCTGTTTGGGGAAGAAAGG - Intronic
916413393 1:164569913-164569935 TGGGACAGATTGGAAGAAGAGGG + Intronic
917042508 1:170821812-170821834 TGGGATAGTTAGAGAGAAAAAGG - Intergenic
918047716 1:180951543-180951565 TGGGACTCTTTGGGAGTGGATGG + Exonic
918283986 1:183034115-183034137 TAAGACTGCTGGGGAGAAAATGG + Intronic
918432514 1:184476794-184476816 TGACACTGTTTTGGAGACAAAGG - Intronic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919496782 1:198282594-198282616 AGGGACTGTTTAGGAGTTAAGGG - Intronic
920739143 1:208563773-208563795 TGGAAATGTTTGGGAAAACATGG - Intergenic
921350569 1:214230333-214230355 GGGGGATGTGTGGGAGAAAAGGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921700276 1:218261514-218261536 TGGCACTGTACAGGAGAAAATGG - Intergenic
923383534 1:233444861-233444883 GGGGACTGCTTGAGAGAAGAGGG + Intergenic
923558366 1:235019769-235019791 AGGGCATGTTTGGGAGAACAGGG + Intergenic
923632191 1:235658559-235658581 TGAGACAGTTTGGGACAAACTGG + Intergenic
923982742 1:239343662-239343684 TGGGACTCTTTTGGAACAAATGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063978370 10:11434792-11434814 TGGAATTTATTGGGAGAAAACGG + Intergenic
1064390071 10:14934570-14934592 TGGGACTGTTGGGAAGGAAAAGG - Intronic
1064400504 10:15017094-15017116 TGGGACTGTTGGGAAGGAAAAGG - Intergenic
1066012799 10:31209785-31209807 TGGGGCTGTTCGGATGAAAATGG + Intergenic
1066193173 10:33074634-33074656 TAGGACTGGCTGGGAGAAATTGG + Intergenic
1066409371 10:35151131-35151153 TGGGAATGTTTTGAATAAAATGG + Intronic
1068517029 10:58037661-58037683 TGGGTATATTTGTGAGAAAAAGG - Intergenic
1069091724 10:64207570-64207592 TGGAAGTGTGTGGGAGGAAAAGG - Intergenic
1071333790 10:84585642-84585664 TGTGACTGGGTGGGGGAAAACGG - Intergenic
1077071944 11:678818-678840 TTGGACTGTTGGGGAGAAAAAGG + Exonic
1077456523 11:2684731-2684753 TAGGTCTGCCTGGGAGAAAAGGG + Intronic
1079222990 11:18580786-18580808 TGTGGGAGTTTGGGAGAAAATGG + Intronic
1079939113 11:26655910-26655932 TAGGAATTATTGGGAGAAAACGG + Intronic
1079962973 11:26946611-26946633 GGGGACTATATGAGAGAAAATGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082852341 11:57776499-57776521 TGGGCCTGCTTTGGAGAAAGAGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084337026 11:68464512-68464534 AGGGACTGTTTGTGAGTTAAGGG + Intronic
1084651363 11:70491306-70491328 TGGGACCCTTTGGGAGATCAAGG + Intronic
1084803302 11:71561003-71561025 TGGCAAAGCTTGGGAGAAAAGGG - Intronic
1085068530 11:73520479-73520501 TGGGACTGTTTCCAAGACAAAGG + Intronic
1085149773 11:74241141-74241163 TGGGAGGGTTGGGGAGAAATGGG - Intronic
1086002188 11:81996991-81997013 GGGGATTGTTTAGGGGAAAAGGG + Intergenic
1086199877 11:84189334-84189356 TGGCAATGTTGTGGAGAAAAAGG + Intronic
1086849295 11:91790618-91790640 AGGCACTGTCTGGGAAAAAAGGG + Intergenic
1088146763 11:106690028-106690050 TGGCAAGGTTTTGGAGAAAAAGG + Intronic
1088369003 11:109067973-109067995 TGTGACTGTTCAGGAGGAAATGG + Intergenic
1088398862 11:109400589-109400611 TGGGAAAGTGTGGGAAAAAATGG - Intergenic
1089248281 11:117138099-117138121 GGGAACAGTTTGGGTGAAAAAGG + Intergenic
1089258430 11:117206462-117206484 GGGAACAGTTTGGGTGAAAAAGG - Intronic
1089705209 11:120272716-120272738 TGAGTCTGTCTGGGGGAAAAGGG + Intronic
1090479254 11:127053666-127053688 TGGGAAGATCTGGGAGAAAAAGG + Intergenic
1090809219 11:130221990-130222012 GGGAACTGTCTGAGAGAAAATGG - Intergenic
1092181902 12:6451926-6451948 TGGGACAGGTGGGGAGCAAAAGG + Intronic
1093502156 12:19825784-19825806 TGGTAATGTTGTGGAGAAAAGGG + Intergenic
1093695308 12:22152540-22152562 TGGGCCTGTTGGGGAGATGAGGG + Intronic
1093912771 12:24766291-24766313 TGTTGCTGTTGGGGAGAAAATGG + Intergenic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094128103 12:27045044-27045066 TGGGTCTGTTATGGAGGAAAAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095709896 12:45277131-45277153 TGGGAAAGTTTGTGAGAGAAGGG - Intronic
1096913677 12:55009620-55009642 TGGAGCCGTCTGGGAGAAAAGGG + Intergenic
1097670787 12:62534849-62534871 TAGGGCTGTTTGGGAAGAAATGG + Exonic
1098147753 12:67515379-67515401 TGGGAATTTCTGGGAGAGAAGGG - Intergenic
1098563453 12:71903841-71903863 TGGGGCTGTTTGAGAGTGAAGGG + Intronic
1099581114 12:84447857-84447879 TGGGAATGTTGCGGACAAAAGGG - Intergenic
1103796211 12:123504943-123504965 TGGCTCTGTCTGGGAGAAAGTGG - Intronic
1104091666 12:125522798-125522820 AGAGACAGTTTGGGAGGAAAGGG - Intronic
1104436506 12:128761182-128761204 TGAGACTTCTTGGGAGAAGATGG + Intergenic
1104752010 12:131245822-131245844 TAGAAGTGTTTGGGAGAAAAAGG + Intergenic
1104962683 12:132495682-132495704 TGGGACTCTGTGGGAGGAACAGG - Intronic
1105334945 13:19459053-19459075 TGGGAAGGTTGTGGAGAAAAAGG - Intronic
1105926236 13:25011346-25011368 TGAAAGTGTGTGGGAGAAAAAGG - Intergenic
1105978665 13:25496225-25496247 GGAGACTGAGTGGGAGAAAAAGG + Intronic
1106038748 13:26069631-26069653 TGAAAGTGTGTGGGAGAAAAAGG + Intergenic
1107152624 13:37129475-37129497 AGGGTCTGGTTGTGAGAAAATGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107430892 13:40339169-40339191 TAGGACATTTTGGGAGTAAAGGG - Intergenic
1108157552 13:47601626-47601648 TGGGGATGTTGGGGAAAAAAAGG - Intergenic
1111708190 13:91777821-91777843 TGAAACTGTTTTGAAGAAAATGG - Intronic
1112152775 13:96782304-96782326 GGCGACTGTTTTGGAGAACAAGG - Intronic
1113380129 13:109796604-109796626 TGGAAGTGTTTGGGAGGTAAAGG + Intergenic
1114359358 14:21953682-21953704 TGGCAAGGTTGGGGAGAAAAGGG - Intergenic
1116014837 14:39394027-39394049 TGTCACTGTGTGGGGGAAAAGGG - Intergenic
1117251197 14:53940399-53940421 TGGGAATGTGAGGGACAAAAAGG + Intergenic
1117428187 14:55623007-55623029 AGGGAGGGTTTGGGAGGAAAGGG - Intronic
1117968140 14:61226658-61226680 TGGCAGTGGTTGGGAGACAATGG + Intronic
1118770841 14:68941758-68941780 TGGGACCGTTTAGTAGACAAGGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119471995 14:74906231-74906253 TGGGCCTGTGTGGGGGAAGAGGG - Exonic
1119507661 14:75186872-75186894 TGAGACTCTATGGGAGAAAGAGG + Intergenic
1120014916 14:79461196-79461218 TGGGACAGCTTTGGAGAAGAGGG + Intronic
1120063503 14:80013044-80013066 TGGGAATTTGTAGGAGAAAATGG + Intergenic
1121459824 14:94066141-94066163 TGGGGCTGTTGGGGAGGACACGG + Intronic
1122386338 14:101350876-101350898 TGGGAATGTGGGGGAGAGAAAGG - Intergenic
1122621213 14:103058333-103058355 TGTGACAGTTTGGTAGGAAAGGG + Intergenic
1124811292 15:32941491-32941513 TTGTATTGTTTGAGAGAAAATGG - Intronic
1125492651 15:40159697-40159719 AGTGACTGTTTGGGAGGAAGGGG + Intergenic
1126771208 15:52057792-52057814 TGGCACTGTTGGGAAGAATAGGG - Intronic
1127201710 15:56660974-56660996 GGGGAGTGTTTGGGGGAGAAAGG + Intronic
1127374090 15:58366858-58366880 TGAGAGTTTTTGGGAGAAAGGGG - Intronic
1129897852 15:79121891-79121913 TGGCACTGTGTGAGAAAAAAAGG - Intergenic
1130159344 15:81383375-81383397 AGGGACCTTTTGGGAGATAATGG + Intergenic
1130257067 15:82330735-82330757 TGGGACGCTTTGGGAGAGGAGGG + Intergenic
1130597883 15:85259255-85259277 TGGGACGCTTTGGGAGAGGAGGG - Intergenic
1131418231 15:92279209-92279231 TGAGACTGTCTGGTAGACAACGG + Intergenic
1135409539 16:22222994-22223016 TGGGAATGGTTGGGGGAAATGGG - Intronic
1135655371 16:24243867-24243889 TGGGACTACTGGGGAGAAATTGG - Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1137691854 16:50433901-50433923 TGGGAGTGAATGGGAGGAAACGG + Intergenic
1138304119 16:55958477-55958499 GGGGACAGTTTGGGAAGAAAAGG + Intergenic
1138839197 16:60477580-60477602 TGACAGTGTTTGGGAGATAATGG - Intergenic
1139112509 16:63908105-63908127 TGGGAACGTTTGTCAGAAAAAGG - Intergenic
1139520530 16:67480387-67480409 AGGCAATGTTTGGGAGAACAAGG - Intronic
1140892563 16:79297786-79297808 AGGGACTGGTGGGGAGAACATGG + Intergenic
1143212470 17:5198840-5198862 AGGGACGGGTTGGGAGGAAAGGG - Intergenic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1146229709 17:31096185-31096207 TGAGAATGTTGGGGAGTAAAGGG + Intronic
1146418821 17:32663323-32663345 AGGCACTGTTTGGGGGCAAATGG - Intronic
1147392857 17:40121406-40121428 TGGGACTGCTGGGGAGGAGAGGG + Intergenic
1148616527 17:49004448-49004470 TGAGACAGTTGGAGAGAAAATGG + Intronic
1148788713 17:50161036-50161058 TGGGAGTGTCTGGGTGGAAACGG + Intergenic
1148992773 17:51680910-51680932 TGGGAATGTTGGGGGGGAAATGG - Intronic
1151943885 17:77308896-77308918 TGGGACTGTATGTGGGAAGAGGG + Intronic
1152305517 17:79518358-79518380 TGACACTGTTTGGGAGAAGCGGG + Intergenic
1153499555 18:5734171-5734193 TGGCACTGGTGTGGAGAAAAGGG + Intergenic
1155270776 18:24139386-24139408 TAGGTCTGTTTGGGAGAGACGGG - Intronic
1155787118 18:29914993-29915015 TGGTATTGTTTTGGGGAAAATGG - Intergenic
1156282412 18:35652746-35652768 AGGGAGTGTTTGGGAGAAGAGGG - Intronic
1156390290 18:36644116-36644138 TGGGACTGTTTGCGGTGAAAAGG + Intronic
1157020178 18:43772048-43772070 TGGGATTGTGTTAGAGAAAAAGG - Intergenic
1157523609 18:48362246-48362268 TGAGTTTGTTGGGGAGAAAAGGG - Intronic
1157730754 18:50002088-50002110 TGGGAATGTTAGGGAAACAAAGG - Intronic
1158284242 18:55861696-55861718 TGGGAGGGATTGGGAGAGAAGGG + Intergenic
1158951273 18:62497665-62497687 AGGGATTGTTTTGGAGAACAGGG - Intergenic
1159663442 18:71127953-71127975 TGGGACTACTTAGGTGAAAATGG - Intergenic
1161545602 19:4878370-4878392 TGTGACTGTGTTGGGGAAAAGGG - Intergenic
1161973728 19:7597250-7597272 AGAGACTGTCTGGGAGAAAGAGG - Intronic
1162612078 19:11764123-11764145 TGGGAAGGTTGTGGAGAAAAGGG - Intergenic
1163349000 19:16763601-16763623 TGGGACTTTCTGGGAGGAATAGG - Intronic
1165286449 19:34846630-34846652 TGGGAGTGTGTGTGAGAGAAAGG - Intergenic
1165581947 19:36873635-36873657 AGGGACTGTCAGGGAGAAAATGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166855996 19:45782850-45782872 TGGGGCTGGGTGGGAGAAAGGGG + Intronic
1167622273 19:50566880-50566902 TGGGGGTGTTGGGGAGAAAGGGG + Intronic
1167666612 19:50826087-50826109 TGGCTCTGTTTGGGATAAACTGG - Intronic
1167778382 19:51578032-51578054 TGGTAGTGTTTGGGAGGTAAAGG - Intronic
1167877759 19:52428452-52428474 TGTGCCTGTGTGTGAGAAAAAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168347950 19:55660009-55660031 TGGGAGTGTTTGGGGGGAAATGG + Intronic
1168490332 19:56803579-56803601 TGGGGCTATTTGGAAGGAAAGGG + Intronic
1168552680 19:57310824-57310846 TGGGACTGATTGAGAAAAGAAGG + Intergenic
926356179 2:12042696-12042718 TGGGGCTGTTTGGAAGAGAGAGG - Intergenic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
927458439 2:23277197-23277219 TGGGAATGTTTGGCAGACACTGG + Intergenic
928020197 2:27698546-27698568 TGGGATTGTCTGGGGGTAAAAGG + Intergenic
928954466 2:36849069-36849091 TGGGACTGAATAGAAGAAAACGG - Exonic
929318339 2:40509026-40509048 TGGTACTGTTGAGGAGAAAATGG - Intronic
929575543 2:43049649-43049671 TGGGAAGGCTTTGGAGAAAAGGG - Intergenic
929642214 2:43593581-43593603 CTAGACTGTTTTGGAGAAAAAGG + Intronic
929823170 2:45289671-45289693 TGGCACTGTGTGGGAGGAAAGGG - Intergenic
931098907 2:58973449-58973471 GGGTACTTTTTGGTAGAAAAAGG + Intergenic
931145625 2:59513858-59513880 TGGCAAGGTTTTGGAGAAAATGG + Intergenic
931648383 2:64446208-64446230 TGGCAAGGTTTTGGAGAAAAGGG + Intergenic
931754269 2:65358435-65358457 ATCAACTGTTTGGGAGAAAAAGG - Intronic
931918816 2:66989871-66989893 TGTAACTGTTTGGGATGAAATGG - Intergenic
932008099 2:67947820-67947842 AGGAACTGTTTGGGATATAAGGG - Intergenic
932137436 2:69243472-69243494 GGGAAATGTTTGGGGGAAAAGGG + Intronic
932766782 2:74475455-74475477 ATGGAGTGTTTGGGAGAAGAGGG + Intronic
934217828 2:90050440-90050462 TGGAAATGTTTAGGAGAAGAAGG + Intergenic
935499142 2:103816913-103816935 TGGGACTCTCAGGAAGAAAAAGG + Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
936688331 2:114855105-114855127 AGGGAATGGTGGGGAGAAAAAGG + Intronic
937362798 2:121240684-121240706 TGAGGCTGTTAGGGAGAGAATGG + Intronic
937438466 2:121897883-121897905 TGGGACTGTTTTGGGAAATAGGG - Intergenic
938776425 2:134545275-134545297 TGAGAGTGTTTGGGAGAGAAGGG - Intronic
939352864 2:141062838-141062860 TGGGAATATTTGGGAGAATTTGG - Intronic
939766204 2:146252600-146252622 TGGAAATGCTTGGGAGAAAGAGG + Intergenic
939825224 2:147007248-147007270 TGGGGTTGTTGGGGAGATAAGGG + Intergenic
940454830 2:153883674-153883696 TGGGAGGATTTGGGACAAAAAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942599771 2:177628951-177628973 TGGGACAGTCTGGCACAAAAAGG + Exonic
943330531 2:186553396-186553418 TGGCAAGGTTTTGGAGAAAAGGG + Intergenic
943844713 2:192630616-192630638 TGGGACTATTATGGAGATAAAGG + Intergenic
944363785 2:198892392-198892414 TGTGATTATTTGGTAGAAAAGGG - Intergenic
944830091 2:203525100-203525122 TGGGACTATTCTGAAGAAAATGG - Intronic
944895525 2:204160056-204160078 TGGAACTATTTGAGAGAGAAGGG + Intergenic
945542589 2:211106625-211106647 TAGAACTGTATGAGAGAAAAAGG - Intergenic
945643308 2:212458683-212458705 AGGGACTGATTTGGAGACAATGG + Intronic
945884971 2:215365564-215365586 TGGGACCGTCAGGGAGAAAATGG - Exonic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
946610682 2:221454560-221454582 TGGGGCTGTTGGTGAAAAAAAGG - Intronic
946818485 2:223605745-223605767 TGGCAATGTTATGGAGAAAAAGG - Intergenic
948080127 2:235198915-235198937 TGAGACTGATTGGGGGATAAAGG + Intergenic
948960457 2:241331384-241331406 TGGGACAATTTGGGGGAGAAAGG - Intronic
1170296731 20:14835124-14835146 TGGCACAGTTTTGGAAAAAAAGG - Intronic
1171082573 20:22202489-22202511 TGGCAATGTTGTGGAGAAAAGGG + Intergenic
1171191359 20:23161790-23161812 TGAGCCTGTGTGGGAGGAAATGG - Intergenic
1173923879 20:46766064-46766086 TGAGAATGTTTGGGGGAAGAAGG - Intergenic
1174146829 20:48458242-48458264 TGTGACTGTGAGGGAGAGAAAGG - Intergenic
1174538921 20:51274248-51274270 TGGGACAGTGTGGGAAAAGATGG + Intergenic
1177618850 21:23560640-23560662 TGGTATGGTTTTGGAGAAAATGG - Intergenic
1178191810 21:30291441-30291463 GAGGACTGTTAGGGATAAAAAGG + Intergenic
1179080870 21:38169741-38169763 TGGCAGTGTTTTGGAGGAAAAGG - Intronic
1179487802 21:41722126-41722148 TGGGAATGTTGAGGAGGAAAAGG - Intergenic
1182104192 22:27677517-27677539 TGTGACTTTCTAGGAGAAAAAGG + Intergenic
1182646389 22:31813142-31813164 TAGGACTGGATGAGAGAAAAGGG - Intronic
1184426276 22:44410915-44410937 TGGGACTGTTCTGGAGGACAAGG + Intergenic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949576003 3:5339787-5339809 TGGGAATTATTGGGAGGAAAAGG + Intergenic
951655245 3:24999922-24999944 TGTGGCTGTTGGGGAGTAAAGGG - Intergenic
951675108 3:25230387-25230409 TGGGGATGAGTGGGAGAAAAGGG - Intronic
952038381 3:29231997-29232019 TGGGTCAGTTTGGAATAAAATGG + Intergenic
952641697 3:35604279-35604301 TTGGTGTGTTTGGGAGAAAGGGG + Intergenic
952953603 3:38543220-38543242 TGGGACTGCTGGTGAGAAAAGGG + Intergenic
952998952 3:38913117-38913139 TGGCAATGTTGTGGAGAAAAGGG - Intronic
954373781 3:50183804-50183826 TGGGGCTGTTTGGGAGCTGAAGG + Intronic
955761920 3:62294774-62294796 TGGGCCTGTTAGGAAGAATAGGG + Exonic
956247715 3:67202935-67202957 TGGGATTGATTGGGCAAAAAAGG - Intergenic
956591954 3:70924542-70924564 TGGGCATACTTGGGAGAAAATGG - Intergenic
958557692 3:95701598-95701620 TTGGATTGTTTGTGAGACAATGG + Intergenic
960754601 3:120997424-120997446 TGGCACAGTTATGGAGAAAAGGG - Intronic
961430130 3:126875387-126875409 TGGGACTGTTGGGGAGCACATGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963838872 3:150084468-150084490 TGTCACTGTTTGGCAGTAAAAGG - Intergenic
965299789 3:166995308-166995330 GGGCACTGTTTTTGAGAAAATGG + Intergenic
965621083 3:170642839-170642861 TGCTACTGTTTGTGTGAAAATGG - Intronic
966387600 3:179417276-179417298 TAGTACAGTTTGTGAGAAAATGG + Intronic
966488432 3:180498384-180498406 TGGCAATGTTGTGGAGAAAAAGG - Intergenic
966922624 3:184623481-184623503 TGGGACTGTGTGAGAGCCAAGGG + Intronic
966936474 3:184712793-184712815 AGGGACTGGTTGGAAGAAAGGGG + Intergenic
967385702 3:188908768-188908790 TGGGACTCCTATGGAGAAAAGGG + Intergenic
967605772 3:191444537-191444559 TGAGAATTTTTGGGGGAAAATGG - Intergenic
968676861 4:1886969-1886991 TGGGAATGTTGGGAAGAAGAAGG - Intronic
970046769 4:11863150-11863172 TTGGACTGGTTGGAAGGAAAAGG - Intergenic
971179992 4:24320988-24321010 TGGGACTCGGTGAGAGAAAACGG - Intergenic
971500160 4:27310276-27310298 TGGGCTTGTTTGGGGGAAAAAGG + Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972230772 4:37070324-37070346 TGGTACCCTTTGGGAGAGAAGGG - Intergenic
972286166 4:37650617-37650639 TGGGCATCTTTTGGAGAAAAGGG + Intronic
972371400 4:38426990-38427012 TGGGATGGTTGGGCAGAAAATGG - Intergenic
974284887 4:59851652-59851674 TGTGACTGATTGACAGAAAAGGG + Intergenic
974297377 4:60019156-60019178 TGGGACTCTATGGGAGAATCGGG + Intergenic
975107134 4:70580378-70580400 TGGCAAGGTTTTGGAGAAAATGG + Intergenic
975666267 4:76738358-76738380 TGGGGCTGTTTGTGGGAAGAGGG - Intronic
976728786 4:88242237-88242259 AGGCACTGTTCAGGAGAAAAAGG + Intergenic
976753517 4:88474966-88474988 TGCAACTGTTTAGGAAAAAATGG - Intronic
977669172 4:99676272-99676294 TGGCAATGTTGTGGAGAAAAAGG + Intergenic
977738175 4:100443839-100443861 TGGCACAGCTTGGTAGAAAAAGG + Intronic
977910771 4:102533214-102533236 TGGGAGTGTCGGGGAGGAAAGGG + Intronic
978025133 4:103864096-103864118 TGGCATGGTTTTGGAGAAAAAGG - Intergenic
978577841 4:110203616-110203638 TGGGACTGTATGGCAAAAAGGGG + Intergenic
979413116 4:120403709-120403731 TGGGTCTTTTCGGGAGCAAAAGG + Intergenic
980803063 4:137777945-137777967 GGCTACTGTTTGGAAGAAAAAGG - Intergenic
981006382 4:139879583-139879605 TGGTAGTGGTTGGGAGAAAATGG + Intronic
981036246 4:140172185-140172207 TGGGATTCTTTGAGATAAAAAGG + Intergenic
981456839 4:144962467-144962489 GGGCACTGTTTTGGGGAAAATGG - Intergenic
981729216 4:147879838-147879860 TGCCACTGTTTGGAAGATAAAGG + Intronic
982091590 4:151884390-151884412 AGGGCATGTTTGGGAGACAAGGG + Intergenic
982570370 4:157043073-157043095 TTGGAGGGTTTGGGAGCAAAGGG + Intergenic
985270071 4:188185512-188185534 TGGGTCTATTTGTGGGAAAATGG + Intergenic
985642039 5:1068026-1068048 TGGCACTGATTGGCATAAAAGGG - Intronic
986822606 5:11483878-11483900 TGGGACTGCCTGGCAGTAAAAGG - Intronic
987550863 5:19379841-19379863 TGGCAAGGTTTTGGAGAAAAAGG - Intergenic
988091950 5:26554512-26554534 TGGCAAGGTTTTGGAGAAAAGGG + Intergenic
990316831 5:54590736-54590758 GGGGACTGTCTGAGAAAAAAGGG - Intergenic
990561708 5:56990202-56990224 TGGGCAGATTTGGGAGAAAAAGG - Intergenic
993350708 5:86846807-86846829 TGGCAAGGTTTTGGAGAAAAGGG - Intergenic
993374495 5:87134403-87134425 TGGCAAGGTTTTGGAGAAAAGGG + Intergenic
993419392 5:87682122-87682144 TGGGACAGTTGTGAAGAAAAGGG - Intergenic
995362973 5:111320151-111320173 TGATACTGCTAGGGAGAAAAGGG + Intronic
995909191 5:117165108-117165130 TGGGTCAGGTGGGGAGAAAAAGG + Intergenic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
996752088 5:126899101-126899123 TGAGATTGTTTGGGATAAAGCGG - Intronic
996922430 5:128784341-128784363 AGGAAGGGTTTGGGAGAAAATGG + Intronic
998235109 5:140391908-140391930 TGGGACTGTCTTGATGAAAAAGG + Intergenic
999442675 5:151614763-151614785 TGGGACTGTTTGTCAGAACTTGG + Intergenic
1000112047 5:158117535-158117557 AGGTACTGTTTTGGAGAATATGG + Intergenic
1001660447 5:173387779-173387801 TGGCAATGTTGTGGAGAAAAAGG - Intergenic
1003200191 6:3952394-3952416 TGGCAGGGTTGGGGAGAAAAAGG - Intergenic
1004303215 6:14476950-14476972 TGGGACTGGGAGGGAGAGAAAGG + Intergenic
1004423925 6:15494932-15494954 TCGGGCTGTTGGGGAGAAGAGGG + Intronic
1004428202 6:15520567-15520589 TGTAACTGTTGGGGGGAAAAAGG + Exonic
1004945724 6:20610413-20610435 TGGCAAGGTTGGGGAGAAAAAGG - Intronic
1005490744 6:26344868-26344890 TGGAGCTGTTTGGAAGGAAAGGG + Intergenic
1005575128 6:27183289-27183311 TTGGTCTGTGTGGGAGAAGATGG - Intergenic
1005981551 6:30840677-30840699 TGGAATTTTTTGGGTGAAAAAGG + Intergenic
1007632249 6:43278993-43279015 TGGGACTGAGTGGGAGACACTGG + Intronic
1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG + Exonic
1008781973 6:55118533-55118555 TGGCACGGTTGTGGAGAAAAAGG - Intronic
1009247095 6:61251990-61252012 TGGCAAGGTTTTGGAGAAAAAGG + Intergenic
1009783160 6:68296380-68296402 TGGCAAGGTTTTGGAGAAAAAGG + Intergenic
1010143808 6:72642616-72642638 TGGCAATGTTGTGGAGAAAAGGG + Intronic
1010680350 6:78791973-78791995 TGGCAAGGTTTGGGAGAAAAAGG + Intergenic
1010771290 6:79834535-79834557 TGGCACAGTTGTGGAGAAAAGGG + Intergenic
1010797627 6:80135827-80135849 AGGGACTGTTGGAGAGAAAATGG - Intronic
1011490826 6:87890170-87890192 TATAACTGTTTAGGAGAAAATGG + Intergenic
1011725567 6:90206971-90206993 TTGGACTGTTTGGGGGGAATTGG - Intronic
1012384260 6:98659813-98659835 TGGGGCTGGTTGGGGGCAAAGGG - Intergenic
1013543458 6:111133746-111133768 TTGGACTGTTTGGGTTGAAAGGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015510634 6:134034919-134034941 TGGCACTTTTTGGGAGAACTGGG - Intronic
1015785564 6:136919514-136919536 TGGGATTGTGTGGCAGAAAAGGG - Intergenic
1015961064 6:138649984-138650006 TGGGAAAGGTTGGGAGAAATGGG - Intronic
1016398357 6:143651198-143651220 TGGCAATGTTGTGGAGAAAAAGG + Intronic
1016763774 6:147769443-147769465 TGTGTGTGTTTGGGAGGAAATGG - Intergenic
1017587369 6:155941893-155941915 TGGGAATGTTTGGGAGAACGAGG - Intergenic
1019136836 6:169914243-169914265 TGGCAAGGTTGGGGAGAAAAAGG - Intergenic
1020533919 7:9370038-9370060 TGGTAAGGTTTTGGAGAAAAGGG + Intergenic
1020575979 7:9929114-9929136 GGTGAATTTTTGGGAGAAAAGGG - Intergenic
1021215586 7:17912300-17912322 TGTCAGTGTTTGGGAGAAACAGG - Intronic
1021245219 7:18253386-18253408 TGGCAACGTTTTGGAGAAAAAGG - Intronic
1022206976 7:28174350-28174372 TGGGACTGTTTGGAAGCCAGAGG - Intronic
1022589828 7:31651029-31651051 AGGGCCTGTTTGCGAAAAAAGGG + Intronic
1022786186 7:33639754-33639776 TGGGACTGTGGGTGAGAGAAGGG + Intergenic
1024561051 7:50645694-50645716 TGAGCCTGTCTGGGAGCAAATGG - Intronic
1024930949 7:54666051-54666073 CGGAACTGTTTGGAAGCAAATGG - Intergenic
1026861898 7:73796015-73796037 TGGCAAGGTTGGGGAGAAAAGGG - Intergenic
1027771569 7:82413575-82413597 TGGAGCTGTTTGGGAAAGAATGG - Intronic
1028094453 7:86743274-86743296 AAGGACTTTTTGGGAGAAATTGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029853570 7:103489980-103490002 GGGGACTATTTGTGAGAAAAGGG + Intronic
1030757389 7:113303950-113303972 TGGGAAGGTTGTGGAGAAAAAGG - Intergenic
1031909665 7:127502340-127502362 TGGGAAGGTTTCAGAGAAAAGGG + Intergenic
1032081976 7:128863786-128863808 CTGGACTGTTTGGGGGAAACAGG - Intronic
1032906422 7:136372719-136372741 TGGGACTATCTGGGAAAACAGGG - Intergenic
1033354380 7:140587600-140587622 TGAGTCTGTCTGGGAGAAAGGGG - Intronic
1034170655 7:149060553-149060575 TAGGATTCTTTGGGGGAAAATGG - Intergenic
1034337377 7:150332247-150332269 TGGGATTGGATGGGAGAAGAAGG + Exonic
1034962862 7:155373353-155373375 AGGGACTGTGTGGGGGAAGAAGG - Intergenic
1035094777 7:156345487-156345509 TGGGACTGTGTGTGAGAGAGTGG - Intergenic
1038161683 8:25045593-25045615 TGGATCTTTTTGGGAGAAGAAGG + Intergenic
1039336687 8:36599083-36599105 TGGAAAAGTTTGGGAGATAAAGG - Intergenic
1039455362 8:37702375-37702397 TGGGACAGATTAGGAGAAAGAGG - Intergenic
1039554268 8:38465794-38465816 TGAGACTGTTTAGCAGAAAGTGG - Intronic
1039944384 8:42117241-42117263 GGGGACTGTTGGCGGGAAAATGG - Intergenic
1040047216 8:42976195-42976217 TGTCAGTGTTTGGTAGAAAAGGG + Intronic
1040758474 8:50809029-50809051 GGGCGCTGTTTGGGGGAAAATGG - Intergenic
1041711982 8:60902782-60902804 TGATACTGTTGGGGAGAAGACGG - Intergenic
1041970730 8:63739202-63739224 TGTGACTGTGTGGGTGAAAAGGG + Intergenic
1043269280 8:78309656-78309678 TGTTACTGTTTTGGAAAAAATGG + Intergenic
1043365315 8:79526178-79526200 TTGGAGTGTGTGGTAGAAAAGGG + Intergenic
1043826478 8:84935623-84935645 TGGCACTTTTTAGGAGATAAAGG - Intergenic
1044318758 8:90778750-90778772 TGGCACAGTTGTGGAGAAAAAGG - Intronic
1045550424 8:103166472-103166494 TGGGAGGGTATGGGAGACAACGG + Intronic
1045936623 8:107686937-107686959 AGTGACTATTTGGGAGAAAGAGG - Intergenic
1046903435 8:119546535-119546557 TTGGACTGTTGGGGAGATGATGG - Intergenic
1047329418 8:123872979-123873001 TGTGACTCTCTGGGAGACAATGG - Intronic
1049125290 8:140781475-140781497 GGGGGCTGCTTGGGAGAAGATGG + Intronic
1049257488 8:141621626-141621648 TGAGGTTGTTGGGGAGAAAACGG + Intergenic
1050349833 9:4730168-4730190 TGGGAGGGTTGGGGAGAAATGGG + Intronic
1051310715 9:15768054-15768076 TGGGACTGCTCGGGACAACAAGG - Intronic
1057834463 9:98432961-98432983 TGGGGGTGTGTGGGAGAAATGGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058364220 9:104188525-104188547 TGGGCTTGTTTGGGAGGCAAAGG + Intergenic
1059210474 9:112510147-112510169 TGAAACTGTTTGGGAGAAGCTGG + Intronic
1059900022 9:118913786-118913808 TAGCACTGTTTGGGAAGAAAGGG - Intergenic
1060121428 9:120994015-120994037 TGAGACGAGTTGGGAGAAAAGGG + Intronic
1060420836 9:123468507-123468529 TGGGACTGCTGGTGAGAAATAGG - Intronic
1060976565 9:127768390-127768412 AGGGGCTGTTTGGAAGGAAATGG - Intronic
1061498132 9:130987237-130987259 TGGGTCTGATTGGGAGAATGAGG - Intergenic
1185843483 X:3415521-3415543 TGGGATAGTTGGGGAGGAAAGGG + Intergenic
1186162588 X:6793276-6793298 TGGGACAGGATGGGAGAAAAGGG + Intergenic
1187055663 X:15739139-15739161 TGGGAAAGTTTGAGAGATAAGGG + Intronic
1187835930 X:23432467-23432489 TGGCAAGGTTTAGGAGAAAAGGG + Intergenic
1188424827 X:30034688-30034710 TGGGAGTGTGGGGGAGAAATGGG - Intergenic
1188810519 X:34649054-34649076 TGGTAAGGTTTTGGAGAAAAGGG + Intronic
1189671751 X:43417983-43418005 TGGGGCTGTTGGGGTGAAAATGG + Intergenic
1189876706 X:45443855-45443877 TGGCAATGTTGTGGAGAAAAGGG + Intergenic
1191152703 X:57238005-57238027 TGGCAAGGTTTTGGAGAAAAAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191891150 X:65942795-65942817 TGGCAAGGTTTTGGAGAAAAGGG - Intergenic
1193261242 X:79408914-79408936 TGGCAAGGTTTTGGAGAAAAAGG + Intergenic
1193305181 X:79941695-79941717 TGGGCCTATTTGAGGGAAAAGGG - Intergenic
1193611239 X:83633753-83633775 TGGCATGGTTTTGGAGAAAACGG - Intergenic
1194137644 X:90166356-90166378 TGGCAATGTTGTGGAGAAAAGGG + Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194640167 X:96394452-96394474 TGTAAGTGTTTGGGAAAAAAAGG - Intergenic
1195495753 X:105531185-105531207 TGGCAATGATTTGGAGAAAAGGG - Intronic
1196563507 X:117178080-117178102 GGGCACTGTTTTGGAAAAAAGGG - Intergenic
1197637710 X:128933840-128933862 TGGGACTTTATAGGTGAAAAGGG - Intergenic
1198479505 X:137028531-137028553 AGGGAGTGTTTGGTTGAAAATGG - Intergenic
1198527330 X:137514680-137514702 TGGCACTGTTTGCCAGACAATGG + Intergenic
1198973624 X:142309821-142309843 TGGGATGGTTTCAGAGAAAATGG + Intergenic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1199203335 X:145119358-145119380 TGGGATTGTTTGTGACACAAAGG + Intergenic
1199765977 X:150941951-150941973 TGGGAGTGTGGGGCAGAAAAAGG + Intergenic
1200289753 X:154860647-154860669 TGGGAATTTCTGGGAGTAAATGG - Intronic
1200483430 Y:3736624-3736646 TGGCAATGTTTTGGAGAAAAGGG + Intergenic
1201795359 Y:17890684-17890706 TTTGACTATTTGAGAGAAAAAGG + Intergenic
1201806197 Y:18015301-18015323 TTTGACTATTTGAGAGAAAAAGG - Intergenic
1202115929 Y:21468718-21468740 TGCGACTATTTGGGGAAAAACGG + Intergenic
1202277701 Y:23142229-23142251 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202277865 Y:23144614-23144636 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202278598 Y:23152020-23152042 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202279360 Y:23163949-23163971 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202285072 Y:23232881-23232903 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202286140 Y:23249591-23249613 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202286605 Y:23256746-23256768 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202287338 Y:23264153-23264175 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202287502 Y:23266537-23266559 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202287667 Y:23268922-23268944 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202287832 Y:23271306-23271328 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202287996 Y:23273690-23273712 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202288162 Y:23276074-23276096 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202288326 Y:23278459-23278481 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202356790 Y:24059766-24059788 TTTGACTATTTGAGAGAAAAAGG + Intergenic
1202430691 Y:24775953-24775975 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202431422 Y:24783359-24783381 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202431725 Y:24788116-24788138 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202432028 Y:24792873-24792895 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202432492 Y:24800023-24800045 GGGGCCTGTTGGGGAGCAAAGGG - Intronic
1202437474 Y:24858115-24858137 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202438240 Y:24870046-24870068 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202438543 Y:24874803-24874825 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202439278 Y:24882210-24882232 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202439442 Y:24884595-24884617 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202439606 Y:24886980-24887002 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202439771 Y:24889364-24889386 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202439936 Y:24891749-24891771 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202440101 Y:24894134-24894156 GGGGCCTGTTGGGGAGCAAAGGG + Intronic
1202513988 Y:25610348-25610370 TTTGACTATTTGAGAGAAAAAGG - Intergenic