ID: 926660019

View in Genome Browser
Species Human (GRCh38)
Location 2:15454733-15454755
Sequence GAGGGTGATCAGAAATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926660019 Original CRISPR GAGGGTGATCAGAAATTTGA TGG (reversed) Intronic
900817265 1:4858084-4858106 GACGGTGATGAGAAACTTGTTGG + Intergenic
904381234 1:30112391-30112413 GAGGGGGATCTGACATTTAAGGG - Intergenic
905059821 1:35130392-35130414 GAGGCTGATCAGAAACTCAAAGG - Intergenic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
910339945 1:86174657-86174679 GAGGGTAATAATGAATTTGAAGG + Intergenic
912093272 1:106108360-106108382 GAGGCTCACCATAAATTTGAGGG - Intergenic
912146763 1:106803737-106803759 GATGGTGCTCAGAAATTTGTGGG - Intergenic
914728755 1:150351813-150351835 GAGGGTGCTGAGATATGTGAAGG - Intronic
915781162 1:158552278-158552300 GAGGATGATCACAAACTTTAGGG - Intergenic
916461069 1:165025010-165025032 GAGGGAGCTGAGGAATTTGAGGG + Intergenic
917193184 1:172440599-172440621 GAGGTTGAGTAGCAATTTGAGGG - Intronic
918265263 1:182836491-182836513 GGGAGTGATCAGAAATATGAGGG + Intergenic
923661064 1:235957655-235957677 GAGGGTAAACAAGAATTTGAGGG - Intergenic
924487029 1:244494660-244494682 GAGGATGATTAGAAGTGTGATGG + Intronic
1062853759 10:768386-768408 GGGGGTGAAGAGAAATTTAATGG + Intergenic
1065986986 10:30964291-30964313 GAGAGTGATCAAAGATTTAATGG - Intronic
1067677768 10:48399875-48399897 GAGGCTGAGCACAAAGTTGATGG - Intronic
1068253558 10:54476623-54476645 AAGGGTGATCAGAAATTTGGAGG + Intronic
1069256709 10:66341215-66341237 GAGGGCGTAAAGAAATTTGATGG - Intronic
1071877507 10:89857397-89857419 CATGGTGATCATAAATTTCATGG + Intergenic
1073058774 10:100720132-100720154 GAGGGTCATAAGGAATCTGAAGG + Intergenic
1073942313 10:108712950-108712972 GATGGTGATGAGGAATTTGTTGG + Intergenic
1074378542 10:112959433-112959455 GAGGGTAAATAGACATTTGATGG + Intronic
1074702429 10:116104312-116104334 GAGGCTGAGCAGGGATTTGAGGG - Intronic
1074858893 10:117494568-117494590 GAAGGACATCAGAAAGTTGATGG - Intergenic
1075250097 10:120861120-120861142 GATAATGATCAGAAATGTGAAGG + Intronic
1077919262 11:6630879-6630901 GAGGGAGAACAGAATTGTGAGGG + Intronic
1077979003 11:7279812-7279834 GAGGAAGATCAGAAATTTCTGGG - Intronic
1078344910 11:10539388-10539410 GAGGTTGATACAAAATTTGATGG - Intronic
1079240036 11:18715688-18715710 GAGGTTGCTCACAAACTTGATGG + Exonic
1080324842 11:31058584-31058606 AATGGTGATCAGAGATATGATGG + Intronic
1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG + Intronic
1085439582 11:76546487-76546509 GAAGAGGATCAGAAAATTGATGG + Intronic
1086014543 11:82150942-82150964 GAGGATGATCAGTAATTTCTAGG - Intergenic
1087812132 11:102620071-102620093 GAGAGTGATAAGAAATTGGTAGG - Intronic
1089060093 11:115619229-115619251 GAGGGAGATGAGAAAGCTGAAGG - Intergenic
1089287450 11:117416875-117416897 AAGGGGGATCAGGACTTTGAGGG - Intergenic
1089663370 11:120000580-120000602 GAGGGTGTTAAGAACTGTGAAGG - Intergenic
1089834729 11:121359960-121359982 GAGTCTGACCAGAAATTGGAAGG - Intergenic
1090566066 11:127993408-127993430 GAGGGTGGGCAGAGATTTCAAGG + Intergenic
1094296879 12:28916582-28916604 GAGGTTGACAAGAAAATTGAAGG + Intergenic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1094487713 12:30938281-30938303 GAGGGTGGACAGACATTTGGGGG - Intronic
1096374833 12:51100384-51100406 AAGGGTGTTTAGAAATTGGAAGG - Intronic
1097252092 12:57640830-57640852 GAGGCTAATCAGAAATTCAAAGG + Intergenic
1097735725 12:63178994-63179016 GATGGAGATGAGAAACTTGATGG + Intergenic
1100145172 12:91668844-91668866 GATGGTTGTCAGAAATTTGGGGG - Intergenic
1103211709 12:119171896-119171918 GAGGCTAATCAGAAACTGGAAGG - Intergenic
1105579266 13:21678042-21678064 GATGGTGAGCAAAAATTTGAGGG + Intronic
1106129259 13:26926054-26926076 GAGGGAGAGGAGAAATTTGCCGG - Intergenic
1107136681 13:36952222-36952244 CATGGTGATCTGAAATTAGAAGG - Intronic
1107251880 13:38373730-38373752 AAGGGTGTTCAGAAAATTCAGGG - Intergenic
1109517141 13:63458386-63458408 GAAGTTGATTATAAATTTGATGG - Intergenic
1110656648 13:78007886-78007908 AAGGGTGATCAGAAATAGGATGG - Intergenic
1110737234 13:78951372-78951394 GAGGGTGAGCAGAAGTTGGGTGG - Intergenic
1110764947 13:79272329-79272351 GTGGTACATCAGAAATTTGAAGG - Intergenic
1111600138 13:90462248-90462270 AAGGGTAATCCCAAATTTGAGGG + Intergenic
1111684690 13:91487538-91487560 GAAGGTGATCAGATCTTGGAAGG - Intronic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1114983851 14:28200262-28200284 AAGAGTGATCAGAATATTGAGGG - Intergenic
1115453422 14:33574601-33574623 GAGGGTGAAAAGTAGTTTGAGGG + Intronic
1115650785 14:35401732-35401754 GAAGGTTATCAAAAATTTCATGG - Exonic
1116494014 14:45538578-45538600 GAGGGAGCTCAGAGATTTAAGGG - Intergenic
1118103409 14:62630593-62630615 AAGGGTGCTCAGGAAATTGAGGG + Intergenic
1118815726 14:69312567-69312589 GAGGGTCATCAGGACCTTGAGGG + Intronic
1121798717 14:96755971-96755993 CAGGGGGAGCAGAAATCTGAGGG + Intergenic
1125310727 15:38375674-38375696 GAGGGTGACCAGAAAAATCACGG + Intergenic
1127257085 15:57301586-57301608 GAAGGTGGTGAGAAATTTTAAGG + Intergenic
1128266077 15:66267811-66267833 AAGGGTGGGCAGATATTTGAAGG - Intergenic
1130125169 15:81087812-81087834 GAGGGAGATCAGAAAGTGCAGGG - Intronic
1130261920 15:82361578-82361600 GAAAGGAATCAGAAATTTGAGGG - Intergenic
1130279312 15:82507432-82507454 GAAAGGAATCAGAAATTTGAGGG + Intergenic
1130622824 15:85481622-85481644 GAAAGGAATCAGAAATTTGAGGG - Intronic
1131834086 15:96373028-96373050 GTGGGTGATGGGAAATTTGGAGG + Intergenic
1134248374 16:12556822-12556844 GAGGAGGAACAGAAGTTTGATGG + Intronic
1136411986 16:30082986-30083008 GGGGGTGGTCAGAGACTTGATGG + Intronic
1136586797 16:31191509-31191531 TTGGGTGATCAGGAATTGGAAGG - Exonic
1137534041 16:49304014-49304036 GAAGGAGATCAGAGTTTTGAGGG - Intergenic
1141264786 16:82487109-82487131 AAGGTTGATCAGAAATTAGCGGG + Intergenic
1141306181 16:82866099-82866121 GAGGGTGATGAGGAACTTGCTGG - Intronic
1141961804 16:87413842-87413864 GGGGGTGAGCAGAAATGAGATGG - Intronic
1143384279 17:6517919-6517941 GAGGTATATAAGAAATTTGATGG + Intronic
1145867777 17:28251700-28251722 GAGGGCGATAAGGAATTTGCGGG - Intergenic
1148382754 17:47211605-47211627 GGGGGTGGTCAGAAAGTTAAAGG - Intronic
1149115968 17:53097058-53097080 GGGGGAGATGAGAAATTTGTTGG + Intergenic
1149222332 17:54429408-54429430 GAGTGTGATAAGGACTTTGAAGG + Intergenic
1153275387 18:3362176-3362198 AAGGATGATCAGACATCTGAGGG + Intergenic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1155804048 18:30143378-30143400 GAGCTTGATAAGAAATTAGAGGG + Intergenic
1158358685 18:56648368-56648390 GAGGGTGACCAGAAACCTGGAGG - Intronic
1162536800 19:11267340-11267362 GAGGGTGATCAGGACTGCGATGG - Intergenic
1163325272 19:16599620-16599642 GAGGGTGATCAGGAGTCAGAGGG - Intronic
925052550 2:828550-828572 GAGGGTCATCTGGAACTTGATGG - Intergenic
926569284 2:14511743-14511765 TAGGGAGATCAAAAATGTGACGG + Intergenic
926660019 2:15454733-15454755 GAGGGTGATCAGAAATTTGATGG - Intronic
926715452 2:15920376-15920398 GAGGGTGATTATATATGTGATGG + Intergenic
927925591 2:27011288-27011310 GAGGGGGATCAGCAGTTAGAGGG - Intronic
928287724 2:30008154-30008176 GAGGGAGAGGAGGAATTTGAGGG - Intergenic
928749818 2:34458409-34458431 GATGGTGATGAGAAATTTCTTGG + Intergenic
930326811 2:49930166-49930188 GAGAGTGAGAAGAAATTTCAAGG + Intronic
933621544 2:84548671-84548693 AATGGTGATGAGAAATTTGTGGG + Intronic
935830588 2:106997471-106997493 GAGGGAGATCAGAGCTGTGATGG + Intergenic
936908295 2:117562993-117563015 GAGGGAGATCAGTTATTTTATGG + Intergenic
939410039 2:141813454-141813476 GAGGGTGCTCAGCAAATTTAAGG + Intronic
939591357 2:144067454-144067476 GAGGACAATAAGAAATTTGATGG + Intronic
941359807 2:164537900-164537922 GAGGGTGGTCACAACTCTGATGG + Intronic
943620312 2:190141059-190141081 GAGGGAGATAAGAAACTTGTTGG - Intronic
943828233 2:192424481-192424503 GAGGGTTATGTGAAATTGGACGG - Intergenic
944507022 2:200423260-200423282 AAGGTTCATCAGAAAGTTGATGG + Intronic
944741310 2:202615430-202615452 GACAGTGCTCAGAAATTTGTGGG + Intergenic
948263478 2:236621318-236621340 GAGGGGGAGCAGAACTCTGATGG + Intergenic
948619373 2:239224505-239224527 GAAGGTGAGCAGACATTTGCAGG - Intronic
1174607202 20:51769247-51769269 GAGGGTGTTCAGACTATTGAAGG - Intergenic
1174988597 20:55484105-55484127 AATGGTGATTAGAAATTAGAAGG - Intergenic
1177010656 21:15727508-15727530 GATAATGATCAGAAATTTGTTGG + Intergenic
1177504437 21:22001691-22001713 GATGGAGATGAGAAATTTGTTGG - Intergenic
1178038333 21:28609945-28609967 GAGGGAGAAGAGAAATCTGAAGG + Intergenic
1183911560 22:41083244-41083266 CAGGGTGATCAGGAATTTGTGGG + Intergenic
949475217 3:4438430-4438452 AAGGGTGATCACACATTTGAGGG - Intronic
950954173 3:17033684-17033706 GAGGGTGATCTGAAATCTAACGG - Intronic
951646746 3:24900247-24900269 GAAGGTGGTCAGAAGTCTGAAGG + Intergenic
952282710 3:31938916-31938938 GAGGGTGGGCAGGAAGTTGAAGG - Intronic
952831496 3:37568740-37568762 GAGGGAGATGAGGAATTTGTTGG - Intronic
953596891 3:44324290-44324312 AAGGGTGATCAGAAATTTAGAGG + Intronic
955299942 3:57768600-57768622 GAGGGTAATTAGGAATGTGATGG + Intronic
955446364 3:59015322-59015344 GAGAGTGATAAGAAATGAGAAGG + Intronic
957754430 3:84468029-84468051 GAAAGTGATCAGACATTTCAGGG + Intergenic
957857078 3:85893003-85893025 GAGGGAGATGAGAAACTTGTTGG + Intronic
957981133 3:87511739-87511761 CTGGGGGATCAGAAATTTGGAGG + Intergenic
958143027 3:89587956-89587978 GACAGTGCTCAGAAATTTGTAGG - Intergenic
959842509 3:110994518-110994540 GAGGATGATCAGATGTTTGAGGG + Intergenic
959846512 3:111039981-111040003 GATGGAGATGAGAAACTTGAAGG + Intergenic
960700759 3:120437111-120437133 GAAGGGGATCAGAAATTTCTCGG + Intronic
962755145 3:138460688-138460710 GAGGGAGATCATAAGTTTGGGGG + Intronic
963473919 3:145779517-145779539 GAGGGAGATCAGAAAAATGTTGG - Intergenic
963774389 3:149423302-149423324 AAGGGTGATCAGATATTGGGTGG + Intergenic
964389967 3:156186634-156186656 GAGGTTGAACAGAAATGAGAAGG - Intronic
965120670 3:164551346-164551368 GAAGTGGTTCAGAAATTTGAGGG - Intergenic
965950318 3:174300546-174300568 GAGGTTGAGAAGAAAATTGAGGG + Intergenic
966696708 3:182797014-182797036 GAGGAAGAACAGAAAGTTGAGGG - Intronic
967335455 3:188339083-188339105 GAGGGTGAGCATATTTTTGAGGG + Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
967921237 3:194616022-194616044 GAGGTGGATCTGAATTTTGAGGG - Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
969208775 4:5670316-5670338 GATGGTGATGATGAATTTGATGG - Intronic
969208788 4:5670457-5670479 GATGGTGATGATGAATTTGATGG - Intronic
969208825 4:5670766-5670788 GATGGTGATAATGAATTTGATGG - Intronic
969927467 4:10598434-10598456 GAGGCTGTTAAGAAATTTGAGGG + Intronic
971079972 4:23198530-23198552 GAGGATGATAAGACAATTGATGG + Intergenic
972976557 4:44643174-44643196 GAGGGAGATGAGAAATTTAGTGG + Intronic
973975914 4:56262214-56262236 GAGAGTCATCTGAAATTGGACGG + Intronic
975024300 4:69530261-69530283 GAGAATGATCAGAATTTTCAGGG + Intergenic
976473151 4:85453055-85453077 GAGGGGAATAAGAAATTTGGGGG - Intergenic
977263019 4:94820610-94820632 GAAAGAGATCAGAACTTTGAAGG + Intronic
977511854 4:97972000-97972022 GAAGGTGATCAGAAAGGTGAAGG - Intronic
978707521 4:111732137-111732159 GATTGTGAACAGAAATTGGAAGG + Intergenic
979059912 4:116044328-116044350 GAGGGAGATGAGAAACTTGTTGG - Intergenic
979718223 4:123867321-123867343 GAGGATGACCAGAAAACTGATGG - Intergenic
980282881 4:130742993-130743015 GAGGGAGATGAGAAACTTGTTGG + Intergenic
980753777 4:137129182-137129204 GAGGATGATCAGAATTATGTAGG - Intergenic
981034790 4:140158145-140158167 GAGTGTGATGAGAAATGAGATGG + Intergenic
981477023 4:145197361-145197383 GAGGGAGATTGGAAAGTTGAAGG + Intergenic
982405755 4:155018443-155018465 GATGGTGTTCAGAAATACGAAGG + Intergenic
983733162 4:171023375-171023397 GAGGGAGGTCAAAAATGTGATGG + Intergenic
984131351 4:175879088-175879110 GATGGAGATGAGAAATTTGTTGG - Intronic
984381728 4:179001708-179001730 TAGGGTGTTCAAGAATTTGAAGG - Intergenic
986033118 5:3911610-3911632 AAGGGTGATCAAACATTAGAGGG - Intergenic
986099648 5:4595448-4595470 GAGGGTGATGAGAAACTTATTGG + Intergenic
987709114 5:21486620-21486642 GAGGGAGATGAGGAATTTGTTGG - Intergenic
988750498 5:34187533-34187555 GAGGGAGATGAGGAATTTGTTGG + Intergenic
991838667 5:70780762-70780784 GAGGGAGATGAGGAATTTGTTGG - Intergenic
991882783 5:71230812-71230834 GAGGGAGATGAGGAATTTGTTGG + Intergenic
992109801 5:73482278-73482300 GAACGTGATTAGAAAATTGAAGG - Intergenic
993767747 5:91882186-91882208 GAGGGTTATCTGAAACCTGATGG - Intergenic
995889525 5:116935130-116935152 GTGGGTGAGAAGAAATTTGAGGG + Intergenic
998483893 5:142485324-142485346 GAGTGTGTTCAGAAATCTGATGG - Intergenic
999418081 5:151417363-151417385 GATGGTGATGAGAAACTTGTTGG + Intergenic
1001287950 5:170437464-170437486 GGGGGTGAGCAGAGATTTGAAGG - Intronic
1003684630 6:8289612-8289634 GAGAGAGAGCAGAAATTGGAAGG - Intergenic
1005548568 6:26893838-26893860 GAGGGAGATGAGGAATTTGTGGG + Intergenic
1006992504 6:38227531-38227553 GAAGGTGATCAGAAAGTGGCTGG + Intronic
1008424624 6:51342706-51342728 GAGGGTTATCTGAAATCGGATGG + Intergenic
1009019324 6:57934945-57934967 GAGGGAGATGAGGAATTTGTTGG + Intergenic
1010826021 6:80476401-80476423 GATGGTGATCAGTGATTTGGAGG + Intergenic
1010875425 6:81098886-81098908 GAAGGATATCAGAAATTGGAGGG - Intergenic
1011217164 6:85017362-85017384 GAGAGTAATCACAAATTGGAAGG - Intergenic
1012788254 6:103658986-103659008 GATGGAGATGAGAAATTTGTTGG - Intergenic
1013037525 6:106400799-106400821 GAGGGTGATCAGTTCTTTAAAGG + Intergenic
1013213807 6:108009246-108009268 GATGGTGATGAGAAACTTGTTGG - Intergenic
1013649550 6:112180699-112180721 TAGGGTGATCATATATTTTATGG + Intronic
1013976857 6:116089107-116089129 GAGTGTGGTCAGCATTTTGATGG - Intergenic
1015901624 6:138074113-138074135 GAGGGAGATGAGAAACTTGTTGG + Intergenic
1015988537 6:138911485-138911507 GATGATGATAAGAAACTTGAAGG + Intronic
1016259087 6:142146254-142146276 GAGAGTGATCAGAAAATAGTAGG + Intergenic
1017723048 6:157257853-157257875 GCGGGTGATCAGGAGTTGGAAGG + Intergenic
1019838447 7:3414238-3414260 GAGGAGGAGGAGAAATTTGAAGG + Intronic
1020578265 7:9961955-9961977 GGGGGTTATCTGAAATTGGAAGG + Intergenic
1021197229 7:17687242-17687264 GAGGGTGATGGGAACTTTTAGGG - Intergenic
1022732189 7:33038462-33038484 AAGAGTGATAAGAAATTTGATGG + Intronic
1022801632 7:33782313-33782335 GAGAGGGATCAGTAATTAGAGGG + Intergenic
1024707047 7:51972262-51972284 AAGGGTGATCAGAACTTTGAGGG + Intergenic
1032729129 7:134620396-134620418 GAAAGTGGTCAGAAATTAGATGG - Intergenic
1033560061 7:142522368-142522390 CAGGCTGCTCAGAAATCTGAGGG - Intergenic
1034745661 7:153521697-153521719 GAGGGTGATGGGAAATTTTTGGG + Intergenic
1036990755 8:13591132-13591154 AAGTGTGATGAGAAATTTTAGGG + Intergenic
1038165038 8:25077691-25077713 GAGGGGGATCAGAGTTTTTAAGG + Intergenic
1039908847 8:41808211-41808233 GGGTGTGATCAGAAATTGCATGG - Intronic
1040021099 8:42742063-42742085 GTGTGTGAGCAGAAATCTGAAGG - Intergenic
1040815739 8:51506873-51506895 GAGGGTGCTCAGACTTATGAGGG - Intronic
1041139255 8:54797636-54797658 AAGGGTTATCTGAAATTGGAAGG - Intergenic
1042472614 8:69208721-69208743 GAGGGTCCTGAGAAATCTGAAGG - Intergenic
1044781720 8:95750373-95750395 GAGGGTGATAAGATATGAGATGG - Intergenic
1044972004 8:97628872-97628894 AAGGATGATCAGAAATGTCAGGG - Intergenic
1045909532 8:107390614-107390636 CAGGATGATCAGAAAATAGAAGG + Intronic
1047010342 8:120665709-120665731 GAGGTTGATGATACATTTGAAGG + Intronic
1047821433 8:128525534-128525556 GGGGGTGATGAAAAATGTGATGG + Intergenic
1049508770 8:143017705-143017727 GAGGGTGTGCGGAAATGTGAGGG - Intergenic
1050265268 9:3883005-3883027 GATGATGACCAGAAATTTGGAGG + Intronic
1050275232 9:3990576-3990598 TAGGGTGAACAGAAATTTCCTGG + Intronic
1050447928 9:5746290-5746312 AAGGGTCATAAGCAATTTGACGG + Intronic
1050727210 9:8664265-8664287 GATGGTGATGAGAAATGAGAAGG - Intronic
1051490769 9:17661707-17661729 GAGTGTGATCAAAAGTTTGCAGG + Intronic
1052645735 9:31230993-31231015 GAGGGTGCTCAGCAATGGGATGG + Intergenic
1053657079 9:40227834-40227856 GAGAGCGATCAGAAATATGCAGG + Intronic
1054357527 9:64076314-64076336 GAGAGCAATCAGAAATTTGCAGG + Intergenic
1054985451 9:71256810-71256832 TAGGCTGATATGAAATTTGAAGG + Intronic
1057026291 9:91736324-91736346 GAGGGTGACCTGAACTTAGAAGG + Intronic
1058283628 9:103149762-103149784 GATGGAGATGAGAAATTTGTTGG + Intergenic
1060191129 9:121593572-121593594 GAGGCTGATCAAAAATTCCAGGG - Intronic
1061368789 9:130186484-130186506 GAGGGAGATGAGAAGTTTGCGGG + Intronic
1186093765 X:6078170-6078192 GATGGTGATCATAGCTTTGAGGG - Intronic
1186769098 X:12800059-12800081 GAGGTTGAGAAGAACTTTGAAGG + Intronic
1186884587 X:13900419-13900441 GAGGGTTACCCGAAATTGGAGGG + Intronic
1187175025 X:16888601-16888623 AAGGTTGAGCAGAAATCTGAAGG + Intergenic
1187755471 X:22520875-22520897 GAGGGTAGTTAGAGATTTGAAGG + Intergenic
1187993684 X:24902992-24903014 GAAGGTTATCTGAAATTGGAAGG + Intronic
1188104158 X:26128775-26128797 GAATGAGATCAGAAATTTGTAGG - Intergenic
1188252655 X:27917333-27917355 GAGGGTAATGAGAAATCTAAAGG + Intergenic
1188506262 X:30888678-30888700 GAGGGTGTTGAGAGATGTGAAGG - Intronic
1189972696 X:46434294-46434316 GAGGGTGGTGTGAAATCTGAGGG - Intergenic
1190088939 X:47420764-47420786 GAGGGTAATCAGAAACTGTATGG - Intergenic
1190448237 X:50552597-50552619 GAGGGAGCTCACAAATTTCATGG + Intergenic
1192856619 X:75018839-75018861 GATGGAGATAAGAAATTTGTTGG - Intergenic
1192993947 X:76492501-76492523 GAGGGTGAGCAGAAACTGGGTGG + Intergenic
1194089152 X:89564221-89564243 GAGGGAGATGAGAAATTTTTTGG - Intergenic
1194501401 X:94685716-94685738 GATGGAGATGAGAAACTTGATGG + Intergenic
1195525998 X:105890221-105890243 GATGGAGATGAGAAATTTGTTGG - Intronic
1195566863 X:106348995-106349017 GACCATGATCAGAAATCTGATGG - Intergenic
1196048141 X:111277798-111277820 GAGTGTGGTGTGAAATTTGAAGG + Intergenic
1196433237 X:115650424-115650446 GAGTGTGCTCAGAACTTAGACGG + Exonic
1198030914 X:132752570-132752592 GACGCTGATCAGAAATGGGATGG + Intronic
1198096131 X:133381520-133381542 GAGAGTTATCTGAAATCTGATGG - Intronic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199187280 X:144929881-144929903 GAGGGTGATTAGACATTTGTGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199955229 X:152736572-152736594 GAGTGTCATCAGAAATTTCCAGG + Exonic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201546391 Y:15167508-15167530 AAGGGAGATCAGAAAATTAAAGG - Intergenic
1202299897 Y:23401349-23401371 GAGAGTGGACAGAAATTTGCTGG - Intergenic
1202570913 Y:26269249-26269271 GAGAGTGGACAGAAATTTGCTGG + Intergenic