ID: 926666665

View in Genome Browser
Species Human (GRCh38)
Location 2:15531899-15531921
Sequence AAATAATCAGAGATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 1, 2: 8, 3: 86, 4: 778}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926666665 Original CRISPR AAATAATCAGAGATGGAGAA TGG (reversed) Intronic
900149722 1:1173042-1173064 AGACACACAGAGATGGAGAAAGG + Intergenic
900878088 1:5360298-5360320 AGATGATCAGATATGGAGAATGG + Intergenic
902551341 1:17221484-17221506 AAAGAATCAGAGCAGGGGAAGGG + Intronic
903133401 1:21293594-21293616 AAATCAGCAGAGATGGAGCCTGG + Intronic
904258232 1:29270985-29271007 AACTAATGAGAGGTGGAGATAGG + Intronic
904352659 1:29918976-29918998 GAAGAAACAGAGATGGAGAAAGG - Intergenic
904608602 1:31712850-31712872 AATAAATCAGAGATCAAGAAAGG + Intergenic
906068413 1:42999251-42999273 ACATAATCAGGAATGGAGAGGGG - Intergenic
906076279 1:43054503-43054525 AAATAAATAAATATGGAGAAGGG - Intergenic
906231343 1:44167253-44167275 AAACAATAAAAGATGAAGAAAGG - Intergenic
906596053 1:47078268-47078290 AAATTATCAAAGTTGGAGATAGG - Intronic
906711537 1:47933974-47933996 AAATAGTCACAGATGGCTAAGGG + Intronic
906895937 1:49772051-49772073 AAATAACTAGAGAGGAAGAAAGG - Intronic
907484127 1:54765317-54765339 AAAAAATTAGAGAAGGAGAATGG + Intergenic
907618144 1:55946105-55946127 AAATAAGTAGTGATGGATAAAGG - Intergenic
908349689 1:63272357-63272379 TATTATTCAGAGACGGAGAATGG + Intergenic
908457977 1:64322516-64322538 AAAAGACCAGAGATGGAGAGGGG + Intergenic
908558764 1:65284298-65284320 AGAAAGGCAGAGATGGAGAAAGG - Intronic
909069511 1:70977628-70977650 AAGTAATCAGAGGTGAAGAGAGG - Intronic
909337848 1:74496715-74496737 ATAAAATCTGAGATTGAGAAAGG + Intronic
909754833 1:79212171-79212193 AAATAAACAGAGATGAGAAATGG + Intergenic
909837793 1:80279110-80279132 AAATAAACAGGGAGGGACAAAGG - Intergenic
910106232 1:83634042-83634064 AAAGAGTCAGAGTTGGAAAATGG - Intergenic
910565035 1:88634009-88634031 AAACAATAAGAGAGGAAGAAAGG - Intergenic
911350523 1:96748078-96748100 AGATTATCAGAGAGGAAGAAAGG - Intronic
912130681 1:106596216-106596238 AAAGAATGAGAAATTGAGAAAGG - Intergenic
912333587 1:108842420-108842442 AAATTATCTGGAATGGAGAAAGG + Intronic
912588537 1:110789305-110789327 AAACAATAAGAGAGGGAGAAAGG + Intergenic
912932004 1:113972446-113972468 AAGTAATGAGAGAAGCAGAAGGG - Intronic
913146715 1:115998637-115998659 ATAAAATCAGAGATGAAAAAGGG - Intronic
913554774 1:119954307-119954329 AGAAAATGAGAGATGGATAAGGG + Intronic
915161489 1:153923360-153923382 AAAGAATGAGAGATGGCCAAAGG - Intergenic
915624891 1:157108351-157108373 TAAGAATCAGAGATTGGGAAGGG - Intergenic
915664887 1:157435295-157435317 GACAAATCAGACATGGAGAAAGG - Intergenic
915752583 1:158225875-158225897 ATATTATCAGAGATAGAAAAAGG - Intergenic
915811215 1:158913570-158913592 ATAAAATCAGAGATGAAAAAGGG + Intergenic
915961104 1:160267486-160267508 AAATAAAGAGAGAAAGAGAAAGG - Intergenic
916076451 1:161202583-161202605 AAGAAATCAGGGATGGACAATGG - Intronic
916158530 1:161884069-161884091 AAATAATCCTAGGAGGAGAATGG - Intronic
916176663 1:162045771-162045793 AAATACTCAGAGATAGGAAAGGG - Intergenic
916825284 1:168436609-168436631 ACAGATTCAGAGATGGTGAAGGG - Intergenic
916917027 1:169417899-169417921 AAATAATAAGAGATAGATATAGG - Intronic
916917444 1:169424235-169424257 TATTTATCAGAGATGAAGAAAGG - Intronic
917001337 1:170364109-170364131 AAAATATCAGAAATGAAGAAAGG - Intergenic
917270336 1:173265719-173265741 AAATGAATAGAGATGCAGAAGGG - Intergenic
917497484 1:175554365-175554387 AAAAAGTCAGAAATGAAGAAAGG - Intronic
917649940 1:177066381-177066403 GAATAATCAGGGATAGGGAAAGG + Intronic
918319161 1:183348516-183348538 AAAAAATCAGAGAAGGAGATTGG + Intronic
918636556 1:186781593-186781615 AAATTATTAGAGATGGAGTCTGG + Intergenic
918777619 1:188655306-188655328 AAAAAATCAGAAAAAGAGAAAGG - Intergenic
919170046 1:193942241-193942263 ATAAAATCAGAGATGAAAAAAGG + Intergenic
919195625 1:194281376-194281398 AAATAATCGCAGATTTAGAAAGG - Intergenic
919267181 1:195284650-195284672 AAAAAATAAGAAATGAAGAAAGG - Intergenic
919378802 1:196828710-196828732 TAATAAATAGAGATGGAGTAAGG + Intronic
920910732 1:210213897-210213919 AAAAAGACAGAGATGGAAAATGG + Intergenic
921584471 1:216931214-216931236 AAATGATTAGGGATGGACAAGGG - Intronic
921655496 1:217731106-217731128 AAACCATTAGAAATGGAGAAAGG - Intronic
921890269 1:220346660-220346682 AAATTGTCAGAGAAGCAGAAGGG + Intergenic
921969464 1:221131517-221131539 AAATTATCAGAGATAAAGATGGG - Intergenic
922076260 1:222247912-222247934 GGATAAACAGAGATGGAGAGGGG - Intergenic
922151440 1:223008191-223008213 AATTAATCAGAGATGGGGGATGG - Intergenic
922412220 1:225387897-225387919 TAATAAACAGGGCTGGAGAATGG + Intronic
923185766 1:231571684-231571706 TAAATATCAGAGATGGAGATAGG + Intronic
924240037 1:242031701-242031723 AATTAAGCAGGGATGGGGAAGGG + Intergenic
1063107093 10:3001919-3001941 AAAGAAACAGAGAAGGAGAGTGG + Intergenic
1063332324 10:5173291-5173313 AACAAATCAGACATGGAGAAAGG + Intergenic
1063518676 10:6721371-6721393 AAGGGAGCAGAGATGGAGAATGG - Intergenic
1063637285 10:7795198-7795220 AAAGAGTGAGAAATGGAGAAGGG - Intronic
1064065430 10:12177192-12177214 AAATAAGCTGAGAAGGGGAAGGG + Intronic
1064279381 10:13937319-13937341 AAGTACTCAGAGAAGCAGAAAGG + Intronic
1064526068 10:16258159-16258181 ACATAATCAGAGAAAGAGAGGGG - Intergenic
1065147687 10:22787754-22787776 ATATAAAAAGAGATTGAGAATGG - Intergenic
1066340111 10:34523993-34524015 AAAAAATAAGAGATAGAAAAAGG - Intronic
1066978669 10:42391715-42391737 GACAAATCAGATATGGAGAAAGG + Intergenic
1067550291 10:47229577-47229599 AAATAAGCAGAAATGGAGCCAGG + Intergenic
1068124397 10:52820782-52820804 AAATAATCAGTTATGAATAAGGG + Intergenic
1068320972 10:55415495-55415517 TCATAATCAGAAATGGAGAAAGG - Intronic
1068500288 10:57834927-57834949 TTTAAATCAGAGATGGAGAAGGG - Intergenic
1068892050 10:62158066-62158088 AAATAATTAGAGGTGGAGAAAGG + Intergenic
1069490915 10:68859964-68859986 AAAGAATCGGAGATGAAGGAAGG + Intronic
1069566878 10:69469356-69469378 AAATTATCAAACTTGGAGAAGGG + Intronic
1069838183 10:71322563-71322585 CAAAAATCAGACCTGGAGAAGGG - Intronic
1070463658 10:76695680-76695702 AAATTATCAGGGATCAAGAAAGG - Intergenic
1070515785 10:77204570-77204592 AATTAATCAGGGAAGAAGAAAGG + Intronic
1071159803 10:82732563-82732585 GAAGAAACAGAGATTGAGAAAGG - Intronic
1071236117 10:83650743-83650765 AAGTAATGAGAGATAAAGAAGGG - Intergenic
1071249244 10:83799780-83799802 AAATAAACAGAAATGAAAAAGGG - Intergenic
1071952185 10:90716293-90716315 AAATAATCAGAAAAGGAATAAGG + Intergenic
1072022952 10:91422231-91422253 ATAGAATCAGAAAGGGAGAATGG - Intronic
1072376586 10:94822901-94822923 AAAAAATTAGAAATGGTGAAAGG - Intronic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1073001012 10:100286322-100286344 AAATTATGGCAGATGGAGAATGG - Intronic
1073663303 10:105501919-105501941 CAAAAATCAGTGATGGAGATGGG - Intergenic
1074579586 10:114706161-114706183 ATATAATTAGAGAAGGAGAAGGG + Intergenic
1074634034 10:115293453-115293475 AAATAATAAGAGAGGAAGAAAGG - Intronic
1075758116 10:124832541-124832563 AAATAATCAGAAATACAGATAGG + Intronic
1076558762 10:131347254-131347276 AAAGAATGAGAGAAGGAGGAAGG - Intergenic
1076925931 10:133487016-133487038 AAATAATAACAGATGAAGCAAGG - Intergenic
1077768390 11:5187403-5187425 ATAGAAAAAGAGATGGAGAAAGG + Intergenic
1077964756 11:7117714-7117736 AAGCAATCAGAGAAGGAGAAAGG + Intergenic
1078075781 11:8159094-8159116 AAAAAATAAGACAGGGAGAAGGG + Intronic
1078384844 11:10880508-10880530 AAATAATCAGCAATGGGGATGGG - Intergenic
1078545358 11:12243001-12243023 AAGTAAACACAGATCGAGAAAGG + Intronic
1078734112 11:14003961-14003983 AAATATGCAGAGATAGATAAGGG - Intronic
1078954659 11:16177964-16177986 AGATAAGCACAGATAGAGAAGGG + Intronic
1079460301 11:20672559-20672581 AAATAACAAGAACTGGAGAATGG - Intronic
1079512135 11:21223641-21223663 AAACAATAAGAGAAGAAGAAAGG - Intronic
1079580914 11:22063562-22063584 AAATCTTCAGTAATGGAGAAGGG - Intergenic
1080029380 11:27645010-27645032 TTATAATCAGAGAGGGAGACAGG + Intergenic
1080998612 11:37638513-37638535 AAAAAATCAAAGATGGACAAAGG - Intergenic
1081037339 11:38165258-38165280 TAAAAATAAGAAATGGAGAAAGG - Intergenic
1081846894 11:46247186-46247208 AAATAATCAGCGAGGCAGATGGG + Intergenic
1082649997 11:55777731-55777753 GAATAGTGAGAGATGGGGAAAGG + Intergenic
1083106381 11:60362157-60362179 AAAGAATCAGATATATAGAAAGG - Intronic
1083226580 11:61288799-61288821 AAATAATCAGAGAAGCTGACAGG + Intronic
1083851840 11:65372527-65372549 ATAGAACCAGAGAGGGAGAATGG + Intergenic
1084077244 11:66789436-66789458 AATTATTCAAACATGGAGAAAGG - Intronic
1085124677 11:73991731-73991753 AAACAATCAAAGGTGGACAAAGG - Intergenic
1085992057 11:81860705-81860727 ATACAATCAGAGATGAAAAAGGG - Intergenic
1085993639 11:81883370-81883392 ACATAATGAGAGATGGATATAGG + Intergenic
1086492865 11:87372950-87372972 AAAGTATCAAAGATGGACAATGG - Intergenic
1086636356 11:89091778-89091800 AAACAATAAGAGAGGAAGAATGG + Intergenic
1087256061 11:95955444-95955466 AAACAATTAGAGAAGGATAAAGG - Intergenic
1087788574 11:102383468-102383490 AAATATGCAAAGTTGGAGAATGG + Intergenic
1087910303 11:103744819-103744841 AAGTAATCAAAAATGGACAAAGG - Intergenic
1088000423 11:104873504-104873526 AAACAAAAAGAGCTGGAGAATGG + Intergenic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1088472740 11:110203578-110203600 TAATAATCACATATGGAAAATGG - Intronic
1088637030 11:111831744-111831766 AAAGAATCATAGATTTAGAAGGG - Intronic
1089193289 11:116671583-116671605 CAAAAATAAGAAATGGAGAAAGG + Intergenic
1089197766 11:116704797-116704819 AAATAAACAGAGAAGAAGAAAGG - Intergenic
1089380324 11:118026052-118026074 CAATAATAAGAAATGGGGAAAGG - Intergenic
1089740499 11:120578837-120578859 AAATACTCAGAGACGGAGGTGGG + Intronic
1089927439 11:122273264-122273286 AAACAGACAGAAATGGAGAATGG - Intergenic
1090237448 11:125159946-125159968 AAAAAATCAGACATGGGCAAGGG + Intergenic
1090542047 11:127717191-127717213 GAATAAACTGAGAAGGAGAATGG + Intergenic
1090867179 11:130711399-130711421 CAACAATCAGAGGTGGAGACTGG - Intronic
1090911763 11:131127253-131127275 AAACAATAAGAGATCAAGAATGG - Intergenic
1090959680 11:131544955-131544977 AAATAATGACAGATTGAGAGGGG - Intronic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091125893 11:133096779-133096801 AAGTCATCAGAGATAGAGATGGG + Intronic
1091135117 11:133181498-133181520 AAAGTATAATAGATGGAGAAAGG - Intronic
1091320778 11:134647772-134647794 GAACAATAAGAGATGGAGAAGGG + Intergenic
1092094329 12:5828726-5828748 AAAGAATCAGGGAGGGACAAAGG + Intronic
1092509784 12:9143236-9143258 GACAAATCAGACATGGAGAAAGG + Intergenic
1092671170 12:10862374-10862396 AAACAATAAGAGAGGAAGAAAGG + Intronic
1092839171 12:12522484-12522506 ATATAAGCAGAGATGGACCAGGG - Intronic
1092937865 12:13380515-13380537 AAGTAAGAAGAAATGGAGAAAGG - Intronic
1093023901 12:14229313-14229335 AAACAATAAGAGAGGAAGAAAGG - Intergenic
1093366043 12:18300689-18300711 AAATAATGAGAGAGAAAGAAAGG - Intronic
1093563042 12:20565538-20565560 AAATAATCAGATATAGAGGTAGG + Intronic
1094074509 12:26458138-26458160 ACTTAACCAGAGATGGAGACAGG + Intronic
1094382956 12:29863534-29863556 AAATAAGCAGAGAGGTAGAGAGG + Intergenic
1094665448 12:32515830-32515852 AAATGATCAGGGATGGATATGGG + Intronic
1095586341 12:43853874-43853896 AAATAGTCAGATATGATGAAAGG + Intronic
1095886888 12:47197685-47197707 TAATAATCAGAAATGAAAAAGGG + Intronic
1096275734 12:50206400-50206422 AAATAACATGAGACGGAGAAAGG - Intronic
1096529885 12:52235883-52235905 AAAGAAGCAGAGAGGGAAAATGG + Intronic
1097623215 12:61966537-61966559 AAATAATGAGTGTTGGTGAATGG - Intronic
1097673244 12:62567252-62567274 AAATAATCACCAATGAAGAAAGG - Intronic
1098165091 12:67688046-67688068 TGATAATCATATATGGAGAATGG - Intergenic
1098722689 12:73922995-73923017 AATAAATCAGTGATGGTGAATGG - Intergenic
1098779852 12:74672953-74672975 AGATAGACAGAGATAGAGAAGGG - Intergenic
1098841131 12:75479431-75479453 AAATTAAGAGAGATGGAAAATGG - Intergenic
1099147637 12:79066729-79066751 AAAAAAACAGAAATGGGGAAAGG + Intronic
1099840947 12:87966365-87966387 AGGTAAAGAGAGATGGAGAATGG - Intergenic
1099978718 12:89573732-89573754 AAATAAACAGCAATGGGGAAAGG + Intergenic
1100401035 12:94230104-94230126 CAGGCATCAGAGATGGAGAATGG - Intronic
1100605771 12:96150779-96150801 AAAGCATGAGAGAGGGAGAATGG - Intergenic
1100643717 12:96507364-96507386 AAGTAAATATAGATGGAGAAGGG + Intronic
1101342124 12:103851976-103851998 AAATAATAAAAGATCAAGAAAGG + Intergenic
1101782772 12:107850174-107850196 AACAAATCAGACATGGAGAAAGG - Intergenic
1102851071 12:116245738-116245760 AAATAAACAAAAATGGAAAATGG + Intronic
1103111594 12:118284630-118284652 AAATAGAAAGAGATGGAGATTGG + Intronic
1103133382 12:118487623-118487645 AACAAATCAAACATGGAGAAAGG + Intergenic
1104509418 12:129363044-129363066 CAATAAACAAAGATGGAGGAAGG - Intronic
1107249786 13:38345937-38345959 AAATACTCTGGGCTGGAGAAAGG + Intergenic
1107268002 13:38580305-38580327 AACTAATAAGAGATAGAGAGAGG + Intergenic
1107747788 13:43530299-43530321 AAAGAATCAGAGCTGTACAAAGG + Intronic
1107831885 13:44381811-44381833 AAATAATATGTGATGGAGACAGG - Intronic
1108160986 13:47638940-47638962 AAATGATCAGAAATGAAGAGAGG - Intergenic
1108587275 13:51881376-51881398 AGATAATGAGAAATGAAGAAAGG + Intergenic
1108632513 13:52300512-52300534 AAGTAAACAGAGAGGCAGAAAGG - Intergenic
1108654189 13:52512079-52512101 AAGTAAACAGAGAGGCAGAAAGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108900142 13:55392497-55392519 AAACAAACAGAGATGGGGGAGGG - Intergenic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1109265358 13:60192549-60192571 AAAGAATCAAGGTTGGAGAAAGG - Intergenic
1109386910 13:61642197-61642219 AAATTATCAGGGATAAAGAAGGG - Intergenic
1109509195 13:63346845-63346867 AAATATTCTGAGAGGAAGAAGGG + Intergenic
1109642856 13:65213074-65213096 AGATAAAAAGAGAAGGAGAAAGG + Intergenic
1109862592 13:68219907-68219929 AAGTAATCACAGATTTAGAAGGG + Intergenic
1110360416 13:74618473-74618495 AAATAATCAGGGATAAAGAGGGG + Intergenic
1110393827 13:75007111-75007133 AAATAAAAGGAGAAGGAGAAAGG - Intergenic
1110867653 13:80414857-80414879 AAATTACCAGAGACAGAGAAAGG - Intergenic
1111331405 13:86764412-86764434 AAATGGTCAGAGAGGGAGAAGGG + Intergenic
1111400192 13:87723726-87723748 AAATAATAAAAGAAGGAAAAAGG - Intergenic
1111475859 13:88746393-88746415 AGATAATCAGAGATTCTGAAGGG + Intergenic
1112199689 13:97262574-97262596 CAAAAATAAGAGAGGGAGAAGGG - Intronic
1112754886 13:102621469-102621491 AACTAAGCAGAGAGGTAGAAAGG + Intronic
1113296790 13:108968274-108968296 TAAGAATCAGAGATGGAAATGGG - Intronic
1113305295 13:109071490-109071512 TAATGATCAGAGCTGGAAAAAGG - Intronic
1113898659 13:113783582-113783604 AGAAAATCAGACGTGGAGAAAGG + Intronic
1114237417 14:20835018-20835040 GAATGATCAGTGAGGGAGAAGGG + Intergenic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114629886 14:24152057-24152079 ACAGGATCAGAGATGGAGACTGG - Intronic
1114696851 14:24633635-24633657 AGAAAAGCAGAGTTGGAGAATGG + Intronic
1114754520 14:25244760-25244782 AAGTGATAAGAGATGTAGAAAGG + Intergenic
1114996570 14:28360483-28360505 AAATGAACAGAAAAGGAGAAAGG - Intergenic
1115083154 14:29481554-29481576 AAATAATCTGAGATGGTTAAAGG - Intergenic
1115289385 14:31752918-31752940 CAATAAACAGAGAGAGAGAAGGG + Intronic
1115369226 14:32593253-32593275 CAATAAGGAGAGATGAAGAAGGG + Intronic
1115386924 14:32808422-32808444 AAATTATCAAGGGTGGAGAAAGG + Intronic
1115572340 14:34678460-34678482 AATTTCTCAGAGATGAAGAACGG + Intergenic
1115815240 14:37156333-37156355 AAATAATAAGAGAAAAAGAAAGG + Intronic
1115915434 14:38307490-38307512 AAATTATCAGAGATAAAAAAGGG + Intergenic
1116171576 14:41408928-41408950 AAATATATAGAGATGTAGAAAGG + Intergenic
1116262000 14:42642029-42642051 AAATAATAAGGGAAGGAGGAGGG - Intergenic
1116372487 14:44153986-44154008 ATATATTCAGAAATTGAGAATGG + Intergenic
1117020747 14:51567771-51567793 AAATAATCAGAAACAAAGAAAGG - Intronic
1117024886 14:51609068-51609090 GAATAATCAGAGAACAAGAAAGG - Intronic
1117143891 14:52817336-52817358 AGATAGTCCGAGATGCAGAAAGG - Intergenic
1117169751 14:53081888-53081910 AAATAATGAGGGAAGGAGAAGGG + Intronic
1117184334 14:53225120-53225142 AAATGATCAGAGAGGAAGTAGGG - Intergenic
1117255326 14:53971500-53971522 CAATAAGCAGAGATAGAGTAGGG + Intergenic
1117296525 14:54385356-54385378 AAATCATCAGTTATGGAGACTGG - Intergenic
1117469877 14:56032608-56032630 AAAAAATCAGGACTGGAGAAAGG + Intergenic
1118179460 14:63477528-63477550 AAAAAAGCAGTAATGGAGAAAGG + Intronic
1118245608 14:64107459-64107481 AAAGAATCAGAGCTCCAGAAAGG - Intronic
1118562845 14:67105889-67105911 AAACAATAAGAGAAGGAGCAAGG - Intronic
1118591535 14:67405706-67405728 AAATAATCAGAAAGAGAGAGAGG - Intronic
1118807029 14:69246700-69246722 GAATAATCAGAAAGAGAGAAGGG + Intergenic
1119245777 14:73105861-73105883 AAAAAAGCAGAGATCGTGAAAGG + Exonic
1119453167 14:74730363-74730385 AAATAATCAGACATGCATAGTGG - Intronic
1120219187 14:81713460-81713482 AAGTGAGCAGAGAGGGAGAAAGG + Intergenic
1120619008 14:86739766-86739788 AAATAATGAAACATGGAGGATGG - Intergenic
1121136517 14:91503861-91503883 AAATAATCTGAAATGGAAGATGG + Intronic
1122380641 14:101303381-101303403 AAATTATCAGAGGTAAAGAATGG + Intergenic
1123879208 15:24659216-24659238 AAGTTATCACAGATGAAGAAGGG - Intergenic
1124690674 15:31819118-31819140 AAATAATAAGAGATTAAGGATGG + Intronic
1125283688 15:38070495-38070517 AAATAATCAATGATTCAGAAGGG - Intergenic
1125496720 15:40202416-40202438 AACTCATCAAAAATGGAGAAAGG - Exonic
1125839603 15:42786791-42786813 CAATAACCAGGGAAGGAGAAAGG - Intronic
1126238053 15:46408610-46408632 AAATAGTCAGAGATGGTGCCTGG - Intergenic
1126522263 15:49608354-49608376 ATAAAACTAGAGATGGAGAAGGG + Intronic
1126717052 15:51529396-51529418 ATAAAATCAGAGATGAAAAAAGG + Intronic
1126880231 15:53086600-53086622 CAAAAATAAGCGATGGAGAAAGG - Intergenic
1127691043 15:61398208-61398230 AAATAAACAGAGAAAGAGAAAGG + Intergenic
1128012637 15:64312486-64312508 CAATAACCAGAAATGGGGAAAGG + Intronic
1128044078 15:64601977-64601999 AAATAAACAGAGCTGCAGGAAGG - Intronic
1128798945 15:70484870-70484892 AAATAATGAAAGATGAAGAGAGG + Intergenic
1128818727 15:70633345-70633367 AACAAAACAGAGAGGGAGAAAGG + Intergenic
1128954440 15:71925463-71925485 AAATAGTAAGAGAGGAAGAAAGG - Intronic
1129316353 15:74747596-74747618 AAATAAGCATTCATGGAGAATGG + Intergenic
1130039585 15:80395060-80395082 CAATGATGAGAGATGGATAATGG - Intronic
1131660330 15:94507361-94507383 AAACAATAAGAGAGGAAGAAGGG + Intergenic
1133123957 16:3632463-3632485 AAATTATCAGGGATAGAAAAAGG - Intronic
1133500041 16:6357254-6357276 AAATAAACAGAGAAGAAAAATGG + Intronic
1134263283 16:12671362-12671384 AAGGAAACAGAGATTGAGAATGG + Intronic
1135852376 16:25975953-25975975 AAATCATCTGAGATGCAGAGAGG - Intronic
1135931911 16:26745519-26745541 AATTACTCAGGGATAGAGAAGGG + Intergenic
1136109155 16:28053796-28053818 AAACAGACAGAGATGGAGAAAGG - Intronic
1136373456 16:29850287-29850309 AGATAATGAGAGATGAGGAATGG - Intergenic
1137325086 16:47425946-47425968 AAACAATAAGAGATAAAGAAAGG - Intronic
1137346939 16:47671185-47671207 TAATAATGACAGATGGAGAAAGG - Intronic
1137416937 16:48291240-48291262 AAATAATCAGAGGTTGGGTAGGG - Intronic
1138222375 16:55263585-55263607 AGATAAACAGAGACGGAGAGAGG - Intergenic
1138256571 16:55568982-55569004 TAAAAATCAGAGAAGCAGAATGG - Intronic
1138315489 16:56066147-56066169 GAATAATCAAAGATGGCCAAAGG + Intergenic
1138434628 16:56990225-56990247 AAATAACCAGCGGTGGAGATTGG - Intronic
1138600382 16:58050485-58050507 AAAAAAACAGAGAGAGAGAAAGG + Intergenic
1139215388 16:65121685-65121707 TAAAAATCAGAAAGGGAGAAGGG - Intronic
1139342981 16:66282348-66282370 AAAAAATAAGCAATGGAGAAAGG + Intergenic
1139798035 16:69498713-69498735 ACATAGACAGAGATGGATAAGGG - Intergenic
1140089110 16:71822389-71822411 AAATAAACAGAGAGGGGAAAAGG + Intergenic
1140681216 16:77386582-77386604 ATATAATGAGGGATGCAGAAGGG - Intronic
1140752179 16:78034753-78034775 AATTAATCAGAGATGGTGTCTGG - Intronic
1140771043 16:78204347-78204369 AAATAATCACATATGAAGAATGG + Intronic
1140895035 16:79317300-79317322 AAAGAATGAGAGATGAAGGAAGG - Intergenic
1144873613 17:18384983-18385005 AGAGAAACAGAGATGGGGAAAGG + Intronic
1146453778 17:32994368-32994390 CCAAAATCAGAGATGGAGCAAGG + Intronic
1146966080 17:37031161-37031183 AAATATTCAGGCATGGGGAAAGG + Intronic
1147354504 17:39883650-39883672 AAATTATCAGGGATGAAGAATGG - Intergenic
1148633212 17:49128188-49128210 AACAAATCAGACATGGAGAAAGG + Intergenic
1148682844 17:49484525-49484547 AAAGAACCAGAGAAGGAGAAAGG - Intergenic
1149765957 17:59278522-59278544 AAATAATAAGAGCTGGCGACTGG + Intergenic
1150222437 17:63504195-63504217 AAACATTCAGAGATGGGCAAAGG - Intronic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1151037433 17:70817698-70817720 AAATAAAAAGAGATGGGCAAGGG - Intergenic
1151302125 17:73234212-73234234 AAAGAATAAGAGATGTAGAAAGG + Intronic
1153825835 18:8874041-8874063 AAATAATCAGAGGTGGAGGTGGG - Intergenic
1153980130 18:10301713-10301735 GAAAACTCAGAGAGGGAGAATGG - Intergenic
1154055014 18:11004328-11004350 CCAGAATCAGAGATGGAGTAGGG - Intronic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1155486391 18:26347489-26347511 AAATACTAAAAGATGAAGAAAGG + Intronic
1155493014 18:26418245-26418267 AAATATTCAGAGATGGCAAGGGG - Intergenic
1155542661 18:26884326-26884348 TAATACCCAGAGAGGGAGAAGGG + Intergenic
1156076960 18:33290472-33290494 AAATAAACAGAGATAGATCATGG + Intronic
1156078062 18:33304618-33304640 AGATAAGCAGAGTTAGAGAAGGG - Intronic
1156703805 18:39856030-39856052 TAATAATCAGTGATTGAGAAAGG - Intergenic
1156882660 18:42099367-42099389 AAATAATGAGAGAAAGAGGAGGG - Intergenic
1157030335 18:43898762-43898784 AAATAATAAGATATGAAGAGTGG - Intergenic
1157879650 18:51308592-51308614 ATAAAATCAGTGATGGAAAAAGG + Intergenic
1157960045 18:52143328-52143350 AAAAAAACGGAGATGGAGATAGG - Intergenic
1157975702 18:52324421-52324443 AAATTATCAAACATGAAGAAGGG + Intergenic
1158529125 18:58242466-58242488 AAATAAGAAGAGGGGGAGAACGG - Intronic
1158864115 18:61620500-61620522 GACAAATCAGACATGGAGAAAGG - Intergenic
1159062829 18:63533812-63533834 AAATAAACATATTTGGAGAAGGG + Intergenic
1159166422 18:64706821-64706843 AAAGACTCAGAGATGAAGTAGGG - Intergenic
1159171828 18:64780255-64780277 GGATAATCAGAGATGCATAAAGG - Intergenic
1160068436 18:75601122-75601144 AAACAATAAGAGAGGAAGAAAGG + Intergenic
1160111874 18:76040338-76040360 AAGAAATCAGGGAAGGAGAAAGG + Intergenic
1160615209 18:80121168-80121190 AAGGAAGCAGAGAGGGAGAAAGG - Intronic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1162858082 19:13484446-13484468 AAAGAAACAGAGATAGAGAGAGG + Intronic
1163538305 19:17891093-17891115 AGATAATGAGCGATGGAGAAAGG - Intronic
1164636401 19:29794686-29794708 AAAAAAACAGAGAGAGAGAAAGG + Intergenic
1164778742 19:30875390-30875412 ACATAAACAGGGCTGGAGAAAGG - Intergenic
1164992968 19:32697865-32697887 TTAAAATCAGAGAGGGAGAAGGG + Intronic
1165296987 19:34935406-34935428 GATTAATCAGGGAGGGAGAAAGG - Intronic
1165475655 19:36028977-36028999 AAAGAGTAGGAGATGGAGAAGGG - Intronic
1165847063 19:38824948-38824970 TTTAAATCAGAGATGGAGAAGGG - Intronic
1165957714 19:39512123-39512145 AAAGAGCCTGAGATGGAGAATGG - Intergenic
1166176675 19:41077662-41077684 AAACAATCAGAAATGAAGAATGG - Intergenic
1166212503 19:41316129-41316151 AAATAAACAGGGAAGGAGGAGGG - Intronic
1166577735 19:43858716-43858738 AAATAATAAGAGAAGAAGTAAGG + Intergenic
1166992206 19:46699293-46699315 AAACAAGAGGAGATGGAGAATGG - Intronic
1167091997 19:47350770-47350792 AACTGAAGAGAGATGGAGAAAGG + Intronic
1167636947 19:50660770-50660792 AAAGAATCAAAAATGCAGAAGGG + Intronic
1168544381 19:57238640-57238662 AAATGAGCATAGATGGAGAAAGG - Intergenic
925653619 2:6120310-6120332 GAATAATCAAAGATGGAAACAGG + Intergenic
925693033 2:6544793-6544815 AAATAAATAGAGAGAGAGAAAGG + Intergenic
926530739 2:14041440-14041462 ATATAATAAGAGAAGGGGAAGGG - Intergenic
926596353 2:14793610-14793632 AGAGGATCAGAGAAGGAGAATGG + Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
926789641 2:16557034-16557056 ATAAAATCTGAGATGGAGACAGG + Intronic
926836881 2:17032792-17032814 AAATTATTGGAGAAGGAGAAGGG - Intergenic
926977869 2:18533023-18533045 AAAAAATCAGGGAAGGAAAAGGG - Intergenic
928448846 2:31359907-31359929 AAATAAGCAGGGATGGGGGATGG + Intronic
928780800 2:34818114-34818136 AAATAATGGGCGATGGAGGATGG + Intergenic
928781318 2:34824809-34824831 AAATAAGATGAGATGGAGACAGG + Intergenic
928849552 2:35728531-35728553 AAATTATCAGAGATAGTGAACGG - Intergenic
929111649 2:38409989-38410011 AAAGAGCCAGAGAGGGAGAAGGG + Intergenic
929266835 2:39928060-39928082 AGAAAATGAGAAATGGAGAAAGG - Intergenic
929297940 2:40269875-40269897 AAGTAAGCAGAGATATAGAAAGG + Intronic
929553863 2:42911725-42911747 AAATAATCAGTGCAGGACAAAGG + Intergenic
929676337 2:43935097-43935119 AAATAATAAAAGATGAAGCAGGG - Intronic
929734618 2:44533801-44533823 AAACAATAAGAGATGAAGAAAGG + Intronic
930539874 2:52691622-52691644 AAGGAATCAGAGCTGGAGAAAGG + Intergenic
930766247 2:55088740-55088762 AAAAAAGCAGAGATGGATCAAGG + Intronic
930865279 2:56116639-56116661 AAAGAGTCAGAGATGGAGTGGGG - Intergenic
931122800 2:59239037-59239059 GAAGAATCAGAGGTGGAGGAGGG + Intergenic
931581926 2:63785278-63785300 AAAGAAGCAGAGGGGGAGAAGGG - Intronic
931600463 2:63997548-63997570 AAAAGATCAGAGATGAAAAAAGG - Intronic
931693732 2:64856911-64856933 AAATAATCAGATGTGGAGGAAGG - Intergenic
931884387 2:66599811-66599833 AAATAAAGAGAGAGGGAGGAAGG - Intergenic
932648195 2:73527614-73527636 ATAAAATCAGAGATTAAGAAGGG - Intronic
933478468 2:82822353-82822375 AAATAATGACAGATGAAGTAGGG + Intergenic
933545321 2:83703762-83703784 AAATAAGCAGAGATATTGAAGGG + Intergenic
933595672 2:84280745-84280767 ATATGCTCGGAGATGGAGAATGG + Intergenic
933929947 2:87139913-87139935 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
934001280 2:87715698-87715720 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
935454806 2:103254915-103254937 AAAAAATTAGGGAGGGAGAAAGG - Intergenic
935554720 2:104496762-104496784 AAATAGACACAGATAGAGAAGGG - Intergenic
935900175 2:107783353-107783375 AAAAAATGAGCTATGGAGAAGGG + Intergenic
936144049 2:109967358-109967380 AGATAGGAAGAGATGGAGAAAGG - Intergenic
936180731 2:110265319-110265341 AGATAGGAAGAGATGGAGAAAGG - Intergenic
936200638 2:110404111-110404133 AGATAGGAAGAGATGGAGAAAGG + Intronic
936362992 2:111823502-111823524 AAAAAAAAAGAGATGGAGAAAGG + Intronic
936476002 2:112840387-112840409 AAATAATCCCAGAAGCAGAAGGG - Intergenic
936830220 2:116635454-116635476 AAACAATAAGAGAGGAAGAAAGG + Intergenic
937572768 2:123384333-123384355 CAAAAATCAGAAATGGGGAAAGG + Intergenic
937837568 2:126487875-126487897 AAAGAGAAAGAGATGGAGAAAGG - Intergenic
937851361 2:126639200-126639222 CTATAATCAAAGATGGTGAAAGG - Intergenic
939058407 2:137391308-137391330 ACATAATCAGAAATGAAAAAAGG - Intronic
939186423 2:138866406-138866428 AAAAAATCAAAGATGCAGGATGG - Intergenic
939317433 2:140569137-140569159 AAATAATAAGAGGTGGATAAAGG + Intronic
939629353 2:144515428-144515450 AATTACTCAGAGATGGGGAAGGG + Intronic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
940266127 2:151840904-151840926 AAATAATAATTGATGTAGAAAGG + Intronic
940604466 2:155902659-155902681 AAAAAGTCAGAGATGGAGTGAGG + Intergenic
940761122 2:157740516-157740538 AAAAATTGAGAGATGGTGAAGGG - Intronic
941059011 2:160824843-160824865 AAACAATAAGAGATGAAGAAAGG - Intergenic
941348594 2:164402730-164402752 AAATAAGCCATGATGGAGAATGG - Intergenic
941475353 2:165945200-165945222 CAATAAGGAGAGAGGGAGAAAGG + Intronic
941573528 2:167201255-167201277 AAAGAAAGAGAGAGGGAGAAAGG + Intronic
941663094 2:168215727-168215749 AAATAATCAGACAAGAGGAAAGG + Intronic
941832347 2:169976244-169976266 AAACAATAAGAGAGGAAGAAAGG - Intronic
942148118 2:173046213-173046235 AATTAATCAAAGATTTAGAAAGG + Intronic
942153235 2:173099636-173099658 AAATAATTACAGCTGAAGAATGG - Intronic
942357580 2:175135084-175135106 AATTAACCAGGCATGGAGAAGGG + Intronic
942600621 2:177637239-177637261 ATATAATGAGAGATGGAGCCAGG + Intronic
943137993 2:183939687-183939709 AAACAATAAGAGAGGAAGAAAGG + Intergenic
943438428 2:187896310-187896332 GAATAAGCAGAGATAGAGAGGGG + Intergenic
944004434 2:194886194-194886216 CAATAACCAGCAATGGAGAAAGG + Intergenic
944405755 2:199381537-199381559 AAAGAAGGAGAGAAGGAGAAGGG - Intronic
944622947 2:201537343-201537365 AAATATTTATAGATAGAGAAAGG - Intronic
945292222 2:208137694-208137716 AAATAAAAAGAGCTAGAGAATGG - Intergenic
945541299 2:211090454-211090476 AAATAATCAAATATTGAGAGTGG + Intergenic
945575960 2:211529147-211529169 AAAAAATTAGAGATGAAAAAGGG + Intronic
945658518 2:212655500-212655522 CAATAATAAGTGATGGGGAAAGG - Intergenic
946080073 2:217110415-217110437 AAATAATGAGAGAGAGAGAGAGG - Intergenic
946123317 2:217536241-217536263 AAAGAAACAGAGACTGAGAAAGG - Intronic
946126988 2:217571479-217571501 AAAGAATCAAAGAATGAGAAAGG + Intronic
946348326 2:219129497-219129519 GATTAATCAGAGAGGGAGGAAGG - Intronic
946635911 2:221725434-221725456 AAACAATAAGAGAGGAAGAAAGG + Intergenic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
946981802 2:225225958-225225980 AAAACTACAGAGATGGAGAAAGG + Intergenic
947000551 2:225450766-225450788 AAATCCTGAGAGATGGAGAGAGG - Intronic
947474933 2:230436113-230436135 AAATAAACAGAGATTATGAAAGG - Intronic
947899651 2:233711003-233711025 AAAAATTCAGAGATAGAAAAAGG - Intronic
948312405 2:236998426-236998448 AAATAAACAAAGAAGGAGGAAGG + Intergenic
948617694 2:239211967-239211989 AAATAGTCAGCTAAGGAGAATGG - Intronic
1168860535 20:1043280-1043302 AAAGACTCTGAGATGGAGATTGG + Intergenic
1168940664 20:1708482-1708504 AAAATATCTGAGATGGAGATAGG - Intergenic
1168977573 20:1979492-1979514 AAATGATCAAGGAGGGAGAAAGG - Exonic
1169635407 20:7685754-7685776 AAATAGTCACAGATAGGGAAGGG + Intergenic
1170050803 20:12143225-12143247 AAAAAATAAAAGATGAAGAAGGG - Intergenic
1170346313 20:15390539-15390561 AATTAAACATAGATGCAGAATGG + Intronic
1170356766 20:15500684-15500706 AAATAATTAGATATGGAAACAGG + Intronic
1170387275 20:15832943-15832965 AAACAATCAGAGAAGGGGAAAGG - Intronic
1170788951 20:19491893-19491915 AACTAATCACTGATGGAGGAAGG - Intronic
1170907179 20:20527119-20527141 AGATAATGAGATATGGATAATGG - Intronic
1171015529 20:21537674-21537696 AAAGAAAGAGAGATAGAGAAAGG - Intergenic
1171422946 20:25030978-25031000 AAGCCATCAGAGATGGAGGAGGG + Intronic
1171725423 20:28615639-28615661 TGATAATAAGAAATGGAGAAGGG + Intergenic
1173090426 20:39965388-39965410 AAATAATTTCAAATGGAGAAAGG - Intergenic
1173309229 20:41881889-41881911 AAATGTTCAGGGATGGATAATGG - Intergenic
1173787568 20:45805654-45805676 AAACAATCAGAGGTTGAGAAAGG + Intronic
1174039579 20:47689365-47689387 AAATGATCAGAGAGAGAGTAAGG - Intronic
1174080250 20:47966062-47966084 AAAGGAGCAGAAATGGAGAATGG - Intergenic
1174302097 20:49589834-49589856 AAAAAGTCAGAGAGGGAGCAGGG - Intergenic
1174561045 20:51431079-51431101 AAATAAGCACATATAGAGAATGG - Intronic
1174889246 20:54372696-54372718 AAATAATAAAAGAGGAAGAAAGG - Intergenic
1175122375 20:56725630-56725652 CAATATTGAGAGATAGAGAATGG - Intergenic
1177000765 21:15609650-15609672 AAGTTATCAGAGATTAAGAAGGG + Intergenic
1177623550 21:23628760-23628782 AAATTGTCAGAGATAAAGAAGGG - Intergenic
1177960756 21:27663159-27663181 AAAAAATAAGAAATGGGGAAAGG + Intergenic
1177970396 21:27782021-27782043 ATAAAATCAGAGATGAAGAAGGG + Intergenic
1178526428 21:33333476-33333498 AAATAATAAGAGAGGAAGAAAGG + Intronic
1179048901 21:37871712-37871734 AGATAAACAGTGATGGAGAGAGG + Intronic
1179433041 21:41338151-41338173 AAATAAGCAAAGAAGGAGAGGGG - Intronic
1180243651 21:46530566-46530588 AAAGACTAAGAGATGGAGAGCGG + Intronic
1180696657 22:17755429-17755451 AATTAATCAGAAAAGGAGAGGGG + Intronic
1181561309 22:23703357-23703379 CAAAAATAAGCGATGGAGAAAGG + Intergenic
1182304790 22:29360429-29360451 TAAGTATCAGAGAGGGAGAAAGG - Intronic
1182312104 22:29416567-29416589 TAAGTATCAGAGAGGGAGAAAGG - Intronic
1182579863 22:31300446-31300468 AAGGAATAAGAGATGAAGAAGGG + Intergenic
1182688157 22:32136676-32136698 TAAGTATCAGAGAGGGAGAAAGG + Intergenic
1182725440 22:32441661-32441683 ATATAAAGAGAGATAGAGAACGG + Intronic
1182858651 22:33540116-33540138 AAATATTCATAGAAAGAGAAGGG - Intronic
1183467837 22:37988819-37988841 AAATCACCAGGGATGGAGGAGGG + Intronic
1183792961 22:40088798-40088820 AAATTATGAGAGAAGGAGGAAGG + Intronic
949139089 3:610431-610453 CAGGAATCAGAAATGGAGAAAGG - Intergenic
949330171 3:2913299-2913321 AAATAATTAGAGATAGGGAAGGG - Intronic
949580012 3:5378267-5378289 AGACAAGGAGAGATGGAGAATGG + Intergenic
949765675 3:7523252-7523274 AAAAGATCAGAAAAGGAGAAGGG + Intronic
949796796 3:7860379-7860401 AAATAATCAGAGATTAAGAAAGG + Intergenic
949991317 3:9581695-9581717 AACAAGTCAGAGATGGAAAATGG + Intergenic
950185415 3:10942285-10942307 CAATAACCAGAGAAGGGGAAAGG + Intergenic
950773543 3:15331747-15331769 AATCAATCAGAGAAGGAAAACGG + Intronic
950975765 3:17242315-17242337 AAATAAACATAGAGGAAGAAAGG - Intronic
951015144 3:17723225-17723247 AAATAATCACACATAGAGAATGG - Intronic
951274212 3:20665411-20665433 AAATAGTGAGAGATGGAGAAAGG - Intergenic
951347817 3:21567373-21567395 AAATAATAAAAGATTGAGGAAGG - Intronic
951535576 3:23737569-23737591 AGAGAAACAGAGAGGGAGAATGG + Intergenic
951546328 3:23829674-23829696 AGCTAATAAGAGAAGGAGAAAGG + Intronic
952106791 3:30079257-30079279 AAAAAGAGAGAGATGGAGAAGGG - Intergenic
952692522 3:36226585-36226607 CAAAAACCAGAAATGGAGAAAGG + Intergenic
953154892 3:40360786-40360808 AAGTAAACAGAGAAGGAAAAAGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
954944069 3:54402195-54402217 AAAAAACAAGAGAGGGAGAAGGG + Intronic
955131947 3:56178840-56178862 AATAAATCAGAGAAGTAGAATGG + Intronic
955643971 3:61116451-61116473 AATTAATCAGAAATGGACTAGGG + Intronic
955677175 3:61460962-61460984 AAGTAATCACAACTGGAGAAAGG - Intergenic
955697933 3:61655266-61655288 CAATAATCAGAGATGAAATAAGG - Intronic
955825347 3:62940302-62940324 AAATAATGAGAGTTAAAGAAAGG - Intergenic
955910827 3:63858533-63858555 AACAGATGAGAGATGGAGAAAGG - Intronic
956063552 3:65373273-65373295 AAAGGAACAGAGATGGGGAATGG + Intronic
956158823 3:66326313-66326335 AAAAAATCAAAGGTGGAAAAGGG + Intronic
956528435 3:70190176-70190198 AAATAAGAAGAGTTTGAGAAAGG + Intergenic
956541689 3:70347465-70347487 AACACAGCAGAGATGGAGAAGGG + Intergenic
957635823 3:82783109-82783131 TAATAATAAGAAAGGGAGAAGGG + Intergenic
957861125 3:85951873-85951895 AGATAATAATGGATGGAGAAAGG + Intronic
957921094 3:86749135-86749157 AAATAATTACACAAGGAGAAGGG - Intergenic
957946481 3:87069613-87069635 GAATAGTCAGAGATGTAGCAAGG + Intergenic
958164777 3:89866567-89866589 AAATGATAATAGAGGGAGAAAGG - Intergenic
958551336 3:95617678-95617700 ACATAATCAGAAATGGCAAAGGG + Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
959048501 3:101501097-101501119 AAATCATCACAGAAGGAAAAAGG - Exonic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
959641940 3:108648707-108648729 AAATAATCACTGATGAATAAAGG - Intronic
959674725 3:109021372-109021394 ACATCAGCAGAGATGGAGAGAGG - Intronic
959806364 3:110558949-110558971 ATAAAATCAGAGATGAAAAAGGG - Intergenic
959827050 3:110810415-110810437 AAAGAATCAGAGATGGAGTAGGG + Intergenic
959873525 3:111355511-111355533 AAAGAAAGAGAGATGGGGAAAGG - Intronic
960037352 3:113115269-113115291 AAATAATCAGAGGCTGAGCATGG + Intergenic
960135562 3:114100743-114100765 AGATAATCAGAGAGGAAAAAGGG - Intergenic
960471433 3:118071023-118071045 ATAAAATCAGAGATGGAAAATGG - Intergenic
960545390 3:118908354-118908376 ATATAATCAGGGAAGGAGACAGG + Intronic
961065464 3:123871221-123871243 AAATTATCAGAAAAGAAGAAAGG + Intronic
961070972 3:123926134-123926156 ATAAAATCAGAGATAAAGAAAGG + Intronic
961267412 3:125654754-125654776 AAATAACCAAAGATTTAGAAAGG - Intergenic
961334766 3:126166264-126166286 CACAAATCAGACATGGAGAAGGG - Intronic
961534413 3:127560946-127560968 AAACAAGCAGAGAAGGGGAAGGG - Intergenic
961918344 3:130400142-130400164 AAAGAACCAGAGATGGAAGATGG - Intronic
962206515 3:133439449-133439471 CACAAATCAGTGATGGAGAAAGG + Intronic
962334159 3:134510957-134510979 AAAAAATCAAAGGTGGACAAGGG - Intronic
962805127 3:138921627-138921649 AAACAATAGGAGTTGGAGAAGGG - Intergenic
962993469 3:140601700-140601722 AAATAATGACAGATGGGGCAGGG - Intergenic
963041537 3:141073793-141073815 ACACAATGAGAGATGGAAAAAGG - Intronic
963093066 3:141504806-141504828 AGATAGTAAGAGATGGAGTAAGG - Intronic
963359218 3:144248975-144248997 AAAGAATGAGAGAGAGAGAAAGG - Intergenic
963419139 3:145037268-145037290 TAATGATCAGAGATGGGAAAAGG + Intergenic
963573989 3:147035846-147035868 AAATTATCAGAGATAAAGAAAGG + Intergenic
963723662 3:148893928-148893950 AAATATTCAGAAATGAAGGAGGG + Intronic
963879135 3:150507906-150507928 AAATAATAGGAGAGGAAGAAAGG + Intergenic
963880932 3:150527430-150527452 AATGAATCTGAGAAGGAGAATGG + Intergenic
964026126 3:152077222-152077244 ATAGAAACAGACATGGAGAAGGG - Intergenic
964114952 3:153126540-153126562 ATAAAATCAGAAATGGAAAAGGG - Intergenic
964211797 3:154236672-154236694 AAATAAGCAGAGATGGGAAACGG + Intronic
964345286 3:155748987-155749009 GAATGATCAGATATGGAGAGTGG + Intergenic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
964837134 3:160951437-160951459 AAATAATAAGATAAGGAAAATGG + Intronic
965122410 3:164578119-164578141 AAAGAATCATAGCTTGAGAAAGG + Intergenic
965303009 3:167027459-167027481 AGATAAACAGGGATTGAGAAAGG + Intergenic
965664547 3:171078952-171078974 AATTACTCAGAGGTGGAGACTGG + Intronic
965989224 3:174796004-174796026 AATTATTTAGAGATGGAGACAGG + Intronic
966421143 3:179735580-179735602 AAAAAATGAGAAAAGGAGAAAGG - Intronic
967694249 3:192513898-192513920 AAACAATTAGAGATAGACAATGG + Intronic
967864965 3:194182466-194182488 AAAAAAGCTGAGAAGGAGAAAGG + Intergenic
968072347 3:195793200-195793222 AAATAATAAGAGATGGGGCCGGG + Intronic
968247311 3:197165118-197165140 AAAGAAGCAGCGATAGAGAAAGG - Intronic
968346017 3:198009386-198009408 AAATGATCAGAGATAAAGAGAGG - Intronic
970548160 4:17150775-17150797 AAATAATCAAAAATGGCAAAGGG + Intergenic
970655161 4:18223066-18223088 AAATCAAAAGAGATGAAGAAGGG - Intergenic
970677851 4:18473268-18473290 TTATAATGAGAGCTGGAGAATGG + Intergenic
970686600 4:18574615-18574637 AAATAATCAGTGAGGGAGGGAGG + Intergenic
970981700 4:22106497-22106519 AAATAAACTGAGGTAGAGAAGGG - Intergenic
971085266 4:23267588-23267610 AAATAAAAAGAAATGGAGATGGG + Intergenic
971881174 4:32375270-32375292 AAAAAATTAAAGATGAAGAAGGG - Intergenic
971917066 4:32884877-32884899 AAAAAAACAGAAATGGAGTAAGG - Intergenic
972357995 4:38299233-38299255 AAAGAAGCAGAGAAAGAGAAAGG + Intergenic
972842565 4:42948791-42948813 TCAGAATCAGAGATGGAGGAAGG + Intronic
972964447 4:44492162-44492184 GAATAATTAGAGAAGTAGAAAGG - Intergenic
973203067 4:47527186-47527208 AAAGACACATAGATGGAGAAAGG + Intronic
973553010 4:52053786-52053808 AGATGATCAAGGATGGAGAAGGG - Intronic
973709230 4:53611545-53611567 AAATAAGTAGAGATGGAGTAAGG + Intronic
973853094 4:54981305-54981327 ATAAAATCAGAGATGAAAAAGGG + Intergenic
974055625 4:56979954-56979976 GAATTAGCAGATATGGAGAATGG - Intronic
974057421 4:56998009-56998031 AATTAATTAGAGACAGAGAAAGG + Intronic
974545179 4:63295813-63295835 AAATAAGAATAGATGGATAAAGG - Intergenic
974596933 4:64026022-64026044 AAAAAATAAGAAATGGGGAAAGG + Intergenic
974718073 4:65697544-65697566 AAATAATCAGTGCTAGAGATAGG - Intergenic
975195130 4:71516041-71516063 AAATAATAAGAGAAAAAGAAAGG - Intronic
976717370 4:88137081-88137103 AAAGAATGAGAGACGGAGAGAGG + Intronic
976976851 4:91176084-91176106 CAAAAATCAGAAATGGGGAAAGG - Intronic
977066554 4:92323707-92323729 AAATCACCAGAGAAGAAGAAAGG - Intronic
977626033 4:99190697-99190719 AAATAATAGGAGGTGCAGAAGGG + Intergenic
978114018 4:104997503-104997525 AAAAAACAAGCGATGGAGAAAGG - Intergenic
978559447 4:110016811-110016833 ACATAATCAGAGATTCTGAATGG - Intergenic
979387175 4:120080522-120080544 AAATCATCAGATATGGAAGATGG - Intergenic
979848705 4:125549522-125549544 AAATATTTAGAGAAGGAGGAAGG + Intergenic
980130734 4:128813185-128813207 ATTTAATCACAGGTGGAGAAAGG + Intronic
980213571 4:129821677-129821699 AATTATTCTGAGATGGAGAAAGG - Intergenic
981044693 4:140254035-140254057 AAATAATTAGAGAGGGAGGCAGG + Intergenic
981317658 4:143356564-143356586 AAATAAGCAGTTAGGGAGAAGGG - Intronic
981325085 4:143436991-143437013 AAATAATCAGCAAGGGAGAAGGG + Intronic
981520552 4:145657406-145657428 ATATAATCACAGATGGGGAGAGG - Exonic
981594607 4:146405343-146405365 AAATGATCAGAGAAGTAGGAGGG - Intronic
981869837 4:149472854-149472876 AAAAAAAAAGAAATGGAGAAAGG + Intergenic
981938434 4:150257437-150257459 AAGTAATCAGGGATGGGCAAAGG + Exonic
982194801 4:152900150-152900172 AGAAAATGAGAGAGGGAGAAGGG + Intronic
982341201 4:154300837-154300859 AAAAAATAAGTTATGGAGAAAGG + Intronic
982731989 4:158965822-158965844 AAATGATGAGAAATGGAGACTGG - Intronic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
982911321 4:161146190-161146212 AAATAATTAGAGGTGGAGACTGG - Intergenic
983169797 4:164522551-164522573 AAAAAATTAGAGGTAGAGAAGGG - Intergenic
983451603 4:167918579-167918601 AATTAATCAGAGAAGAAGGAAGG - Intergenic
983476776 4:168221671-168221693 AATTCATTAGAGATGGAGATGGG + Intronic
983518577 4:168682312-168682334 AAATAATCAGTGATGCTTAAAGG + Intronic
983597903 4:169491157-169491179 AAAAAAAGAGAGATGGAGAAAGG + Intronic
983763470 4:171445037-171445059 GAAGAATCAGAGAAAGAGAAAGG + Intergenic
984172147 4:176372414-176372436 ACATAATCAGAAATGAAAAAAGG + Intergenic
984204924 4:176775843-176775865 AAACAATCAGAGATGGTCAAGGG + Intronic
984605243 4:181778429-181778451 AAACTTTCAGAGATGAAGAACGG + Intergenic
984693862 4:182759305-182759327 AATAAATCAGAGATGTAGACAGG + Intronic
985137670 4:186803559-186803581 AAATAATAAGGGAAGGAGTAAGG - Intergenic
985507697 5:293281-293303 ATACTGTCAGAGATGGAGAAAGG + Intronic
985507706 5:293371-293393 ATAATGTCAGAGATGGAGAAAGG + Intronic
985507716 5:293461-293483 ATACTGTCAGAGATGGAGAAAGG + Intronic
985740257 5:1611668-1611690 ATACTGTCAGAGATGGAGAAAGG - Intergenic
985740267 5:1611758-1611780 ATACTGTCAGAGATGGAGAAAGG - Intergenic
985740276 5:1611848-1611870 ATACTGTCAGAGATGGAGAAAGG - Intergenic
985919151 5:2955353-2955375 AAACAATAAGAGAAGAAGAAAGG - Intergenic
986647482 5:9931754-9931776 AAACAATCAGAAATGGAAACAGG + Intergenic
987251802 5:16108190-16108212 ACATAATCAGAGCTGGAGTGGGG + Intronic
987727790 5:21725340-21725362 AAATTATCAGAGATATAAAAAGG - Intergenic
987837185 5:23177082-23177104 AGATAAACAAAGATGAAGAAGGG - Intergenic
987859895 5:23471160-23471182 ACATAGCAAGAGATGGAGAAAGG + Intergenic
988097325 5:26633606-26633628 AAATAAAAAGAGCAGGAGAAAGG + Intergenic
988230994 5:28479427-28479449 AAAAAAGCAGAGAAGGAAAAGGG - Intergenic
988236627 5:28553874-28553896 ATAAAATCAGAGATGAAAAAAGG - Intergenic
988321679 5:29705689-29705711 AAGAAATCATAGATGGATAAGGG + Intergenic
988381588 5:30503507-30503529 AGATATTCAGAGATGTAGAAAGG + Intergenic
988441114 5:31234423-31234445 AAACCATCAGAGATTGATAATGG + Intronic
989472360 5:41835120-41835142 ATAAAATCAGAGATGAAAAAGGG + Intronic
989574274 5:42974884-42974906 AGAAAGTGAGAGATGGAGAAGGG + Intergenic
989620255 5:43377098-43377120 AATTAATCAGAGAAGAAGAGAGG - Intronic
989982838 5:50664630-50664652 AAATATTCGGAGATGGGGCAAGG + Intergenic
990011100 5:50999210-50999232 AAATAATCAAAGATGAAGAATGG - Intergenic
990085313 5:51969268-51969290 AATTAATCAGAGAAGAAGACGGG - Intergenic
990371453 5:55123257-55123279 GCCTAATCAGAGGTGGAGAATGG - Intronic
990480913 5:56209776-56209798 AAATAATCACAAATGCACAAAGG - Intronic
990566661 5:57036564-57036586 AGAGAAGCAGAGAAGGAGAAAGG + Intergenic
990721668 5:58702682-58702704 AAATAAAAAGAAAAGGAGAAAGG - Intronic
990828261 5:59926667-59926689 ATAAAATCAGAGATGAAGAAGGG + Intronic
991279239 5:64892417-64892439 AAAATATCAGAAATGTAGAAAGG + Intronic
991389210 5:66124513-66124535 GAATAGTCAAAGATGAAGAAAGG + Intergenic
991564413 5:67989891-67989913 AATTAATGAGGGAGGGAGAAGGG + Intergenic
991615139 5:68489177-68489199 AACTAATCAGAAATGGAGCCAGG + Intergenic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
992491648 5:77250367-77250389 GAATCATCATAGAGGGAGAATGG - Intronic
992758294 5:79929808-79929830 AACTAAGCAGGGATGGAGAATGG + Intergenic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
993528470 5:88996139-88996161 AAATATTCAGACATGGGTAAGGG + Intergenic
993604360 5:89970085-89970107 AAGGAATCAAAGATGGAGAATGG + Intergenic
993854369 5:93055164-93055186 TAATAGATAGAGATGGAGAATGG - Intergenic
994492672 5:100466873-100466895 AAACAACAAGAGATGAAGAAAGG - Intergenic
994816291 5:104591897-104591919 GACAAATCAGACATGGAGAAAGG - Intergenic
995368731 5:111393962-111393984 AGTGAAACAGAGATGGAGAAGGG + Intronic
995444413 5:112226700-112226722 AAAAAATCAGAGAAGAAAAATGG + Intronic
995706398 5:114992623-114992645 ATTAAATCAGAGAGGGAGAAGGG - Intergenic
995981704 5:118112285-118112307 AAATCATCACAGAAGGAGAAAGG - Intergenic
996250838 5:121329684-121329706 AAATAATCAGAGGTTTAGCAGGG + Intergenic
997168676 5:131690752-131690774 AAATTATCAGAGATAAAGAGGGG + Intronic
997252754 5:132402980-132403002 AAATAACAAGAAATGGGGAAAGG + Intergenic
997274990 5:132578106-132578128 AAAAAATCAGAGATGGGGCTGGG - Intronic
997378053 5:133411917-133411939 AAATAATTAGAGGTGAAAAACGG + Intronic
997520415 5:134520038-134520060 AAAGTAACAGAGCTGGAGAATGG + Intergenic
998084574 5:139308080-139308102 ACAGATTAAGAGATGGAGAAAGG + Exonic
998223387 5:140306473-140306495 AAATAAAAAGAAAGGGAGAAAGG + Intergenic
999075480 5:148791443-148791465 TAAGAGTCAGAGATGGAAAAAGG - Intergenic
999337024 5:150729463-150729485 AAATAATGAGGGATGAGGAATGG - Intronic
999485945 5:151996229-151996251 AAATAATAAGAGAGAAAGAAAGG - Intergenic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000533298 5:162450565-162450587 AATTAGTCAGGGATGGAGACAGG - Intergenic
1000619466 5:163466323-163466345 AAATATTCAGAGTTGGAAAAAGG + Intronic
1000866922 5:166525252-166525274 AAATAACCAGAAAAGGAGACTGG + Intergenic
1001158371 5:169292675-169292697 AAATAGTGGGAGATGGGGAAAGG + Intronic
1001239872 5:170060435-170060457 AATTCAACAGAGATGGAGGAGGG - Intronic
1001268255 5:170291029-170291051 AAAGAAAGAGAGATGGAGAGAGG + Intronic
1001324530 5:170712450-170712472 AAAGAAGCAGAGAGGGGGAATGG + Intronic
1003384640 6:5655861-5655883 AAATACTCAGAGACAGAGATGGG - Intronic
1003586416 6:7393458-7393480 AAATTATCAGAAATACAGAAAGG - Intronic
1003648077 6:7932412-7932434 ACATAAACAGAGAGGAAGAAAGG - Intronic
1004033537 6:11898424-11898446 AAATTATCAGAGATAAGGAAGGG - Intergenic
1004544337 6:16582803-16582825 AAAGACTCAGAGAGGAAGAAAGG - Intronic
1004828750 6:19453733-19453755 AAAATATGAGATATGGAGAAGGG - Intergenic
1006235591 6:32628138-32628160 AAATATTTAGTGATGGAGGAAGG + Intergenic
1006493641 6:34405470-34405492 AATTAATCAGAGAAGAAGGAGGG + Intronic
1006971645 6:38051306-38051328 AAATAATCAGTGATCTAAAAAGG + Intronic
1007014165 6:38446531-38446553 AAATAAGGGGAGAGGGAGAAAGG - Intronic
1007198640 6:40085962-40085984 AAAGAATCAGAAATGAGGAAAGG - Intergenic
1007868682 6:45006737-45006759 AAAAGTTTAGAGATGGAGAAGGG - Intronic
1008202454 6:48607823-48607845 GAATCTTCAGAGATAGAGAAGGG + Intergenic
1008225776 6:48914210-48914232 AAATAAACAAAATTGGAGAATGG - Intergenic
1008354395 6:50534085-50534107 AAAGAAAGAGAGAGGGAGAATGG + Intergenic
1008500216 6:52173674-52173696 CAATCATCAGAGCTGCAGAAAGG + Intergenic
1008737821 6:54568289-54568311 AAATTATCCGAGATAAAGAAGGG - Intergenic
1009038945 6:58154385-58154407 ATAAAATCAGAGATGTAAAAGGG - Intergenic
1009324670 6:62336344-62336366 AAATAGACAGACATGGAGGATGG + Intergenic
1009473202 6:64054536-64054558 AAATGATAAATGATGGAGAAAGG + Intronic
1009704349 6:67226519-67226541 GAAAATTCAGAGTTGGAGAAGGG - Intergenic
1009901963 6:69818709-69818731 TAGTAAACAGAGAAGGAGAAAGG + Intergenic
1010561832 6:77360464-77360486 ACATAATCGTAGCTGGAGAAAGG + Intergenic
1011051221 6:83152576-83152598 AAAGAATAGGACATGGAGAAGGG - Intronic
1011089593 6:83581995-83582017 AAATAAACAGAAACAGAGAAAGG + Intronic
1011217794 6:85023519-85023541 AAAAAATCAGAGAGAAAGAAAGG + Intergenic
1011724373 6:90194310-90194332 AAAAAATCAAAAATGGAAAATGG - Intronic
1011870939 6:91891839-91891861 AATTAATCAGGGAAGAAGAAAGG + Intergenic
1012018334 6:93881935-93881957 AAAAAACAAGAAATGGAGAAAGG - Intergenic
1012477199 6:99626865-99626887 AAAAAAAAAGCGATGGAGAAAGG + Intergenic
1013401613 6:109802175-109802197 AAAAAGTCAGAGATGGGTAAAGG - Intronic
1014421208 6:121247513-121247535 AAAGAAACAGAGTAGGAGAATGG + Intronic
1014685576 6:124495780-124495802 AAAGAATCAGAGATGGATCCTGG - Intronic
1014737509 6:125111649-125111671 AAGGAAGAAGAGATGGAGAAAGG - Intergenic
1015207416 6:130655609-130655631 AAGTGACCAGAGATGCAGAAAGG - Intergenic
1015746844 6:136519160-136519182 AAATAATAGGGGATGGAGCAAGG - Intronic
1016182406 6:141163172-141163194 AATTAATCAGGGAAAGAGAAAGG + Intergenic
1016595726 6:145797668-145797690 AAAGAGTGAGAGAGGGAGAAGGG + Exonic
1016758060 6:147708555-147708577 AAATGATCAGAGCTAGAGAAGGG + Intronic
1017359530 6:153550809-153550831 AAATACTCAGAAATGATGAATGG + Intergenic
1017360979 6:153570924-153570946 AAACTATCAGAGATTGAGAAAGG - Intergenic
1017455147 6:154594737-154594759 AAAGACTCAGGGAAGGAGAAAGG - Intergenic
1018334592 6:162773003-162773025 AAAGACTGAGAGATGAAGAATGG + Intronic
1018496621 6:164353969-164353991 CAATAACCAGCAATGGAGAAAGG - Intergenic
1018546267 6:164939993-164940015 AAGTTATCAGAGATAGAGAGAGG + Intergenic
1018961675 6:168453867-168453889 AGAGAGACAGAGATGGAGAATGG - Intronic
1019021487 6:168922476-168922498 AGATAATCAGAAATTGACAATGG + Intergenic
1020352022 7:7230981-7231003 AAAAATTCAGAGATGTAGGAAGG - Intronic
1020505292 7:8979297-8979319 AGATAGACAAAGATGGAGAATGG + Intergenic
1020591125 7:10138476-10138498 AGATAATCAGATATCGAGGATGG - Intergenic
1020995181 7:15254764-15254786 ACAAAATCAGAGATGAAAAAGGG + Intronic
1021330854 7:19337875-19337897 AAAAAAAGAGAGATAGAGAAAGG - Intergenic
1022229971 7:28405260-28405282 AAATTAACAGTGATGGGGAAAGG - Intronic
1023514471 7:40987239-40987261 GACTCATCAGAGATGGACAAAGG + Intergenic
1024340934 7:48258435-48258457 AAACAATCAGAAATGAAAAAGGG - Intronic
1024415361 7:49099142-49099164 AAACAATCAGAAATGGCAAATGG - Intergenic
1024682027 7:51700668-51700690 AAATATAAAGAGAAGGAGAAAGG + Intergenic
1026228576 7:68463701-68463723 ATAAAATAAGACATGGAGAAAGG + Intergenic
1026421841 7:70246630-70246652 AAATAATAAGAGGTGGGGGAGGG - Intronic
1027525364 7:79262146-79262168 AAATATTTAGAGATAAAGAAAGG - Intronic
1027943622 7:84717601-84717623 AAAGAGTTAGAGAAGGAGAAGGG + Intergenic
1028066150 7:86387475-86387497 AAATATTCAGATATGGAATATGG - Intergenic
1028522616 7:91748604-91748626 AAAGGATAAGAGATGGGGAAAGG + Intronic
1028566134 7:92233310-92233332 AAATAAGCTGAGATGCAGAGAGG + Intronic
1029856137 7:103518696-103518718 AAAGAATGAGAGAGAGAGAAAGG - Intronic
1029928952 7:104350473-104350495 TATTAACCAGAGATGGATAAAGG + Intronic
1030394437 7:108967701-108967723 AAAAAATGAGAGATGGAAGAAGG - Intergenic
1030586726 7:111429878-111429900 TCAAAATCAGAGATGGAAAAGGG + Intronic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030741182 7:113111612-113111634 AAATAATCTGAAATAGAAAATGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1030872996 7:114780755-114780777 AGATAATCAGAGAAGGAGCAGGG - Intergenic
1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG + Intergenic
1031389012 7:121190115-121190137 AAAAAGTCAGAGAATGAGAAGGG + Intronic
1031699472 7:124905362-124905384 CAATAACAAGAAATGGAGAAAGG + Intronic
1031926597 7:127644305-127644327 AAATAAAGAGAGAGAGAGAATGG + Intergenic
1032390282 7:131551449-131551471 ACATAATCAGAGAAAGAGAATGG - Intronic
1033105765 7:138521199-138521221 AAATAATAGGAGATACAGAAAGG + Intronic
1033134778 7:138775268-138775290 AAATAATCAGAGGTGGGGAGGGG - Intronic
1033495684 7:141892246-141892268 AAATAATAAGAGATTTAGTAAGG + Intergenic
1033939654 7:146636659-146636681 AAATAATCAGTGAAGCTGAAGGG - Intronic
1034628240 7:152510624-152510646 AAATAAACAGAAATAGAGATGGG + Intergenic
1035256958 7:157635534-157635556 GAACAATCAGAGGGGGAGAAGGG + Intronic
1035462826 7:159055668-159055690 AAAAAATAAGAGAGGGAAAAAGG - Intronic
1035829097 8:2675549-2675571 AATTACTCAGATACGGAGAAAGG + Intergenic
1036093819 8:5700940-5700962 AAATTATCAGGGATGGAGAGAGG - Intergenic
1036965011 8:13287772-13287794 AAATATTCAAAGATAAAGAAAGG + Intronic
1037005438 8:13773984-13774006 AAATAATCAGAAATTGATAATGG + Intergenic
1037289930 8:17339643-17339665 AAATGTTCATAAATGGAGAATGG - Intronic
1037422365 8:18716551-18716573 AAATAATGAGAGATGAGGCAGGG + Intronic
1038529508 8:28306517-28306539 AAAGAATGAGAGAAGGAAAATGG + Intergenic
1038702875 8:29866176-29866198 AAATTATCAGAGATAAAGAGAGG + Intergenic
1038837711 8:31146474-31146496 AAATAATGAGAGATTGAAATAGG - Intronic
1039311873 8:36325154-36325176 AAATAATTAGTAATGAAGAAAGG - Intergenic
1039371020 8:36983984-36984006 ACATAATAAGAAATGGGGAAGGG - Intergenic
1039595330 8:38786543-38786565 AAATAAATAAATATGGAGAATGG + Intronic
1039828898 8:41197305-41197327 AAATAATCACAGATGCTGAGAGG + Intergenic
1040054592 8:43046649-43046671 GAATAAACAAGGATGGAGAAAGG - Intronic
1040365807 8:46713885-46713907 ATATAATCAGAGAGAGAGAGGGG - Intergenic
1040486611 8:47878617-47878639 ACAGAAACTGAGATGGAGAAGGG - Intronic
1040607855 8:48952207-48952229 AAACAATCAGCCAGGGAGAAAGG - Intergenic
1040623342 8:49115175-49115197 AGATAGTCAGTGAGGGAGAACGG - Intergenic
1040960207 8:53023887-53023909 AATTAACAAGAGATGGAAAATGG + Intergenic
1040995992 8:53402964-53402986 AATTAGTCAGTCATGGAGAAAGG + Intergenic
1041178071 8:55218044-55218066 AAATAATAGGAGATGGAGAAAGG + Intronic
1041566947 8:59289255-59289277 ACATAAGCAGAGATGAGGAAGGG + Intergenic
1041883072 8:62775252-62775274 ATAAAATTAGAGATGAAGAAGGG - Intronic
1041931308 8:63290108-63290130 AGATAATTAGAGAAGTAGAATGG - Intergenic
1042255828 8:66802676-66802698 AAAGAAAGAGAGAGGGAGAAGGG + Intronic
1042328286 8:67551289-67551311 AAAAAATAAGCAATGGAGAAAGG - Intronic
1042962317 8:74317006-74317028 ATATAATCAGAAATGGAAAGAGG - Intronic
1043116261 8:76257113-76257135 AAATAATAAGAGAGAGAAAAAGG + Intergenic
1043186242 8:77154210-77154232 AGCTCATCAGAGATGGGGAACGG - Intergenic
1043642774 8:82477157-82477179 AAAGAATATGAGATGAAGAAAGG - Intergenic
1043680358 8:83017525-83017547 ATCCAATCAGAGATAGAGAAGGG + Intergenic
1045074012 8:98542502-98542524 AAAAAAAGAGAGATGGAGCAAGG + Intronic
1045375011 8:101563340-101563362 AAAAAATCTGAGATGGACCAAGG - Intronic
1045729403 8:105217738-105217760 AAAAAATAAGAAATGGGGAAAGG - Intronic
1046010467 8:108540115-108540137 AAATAACTAGAGATTGTGAAGGG - Intergenic
1046495233 8:115005487-115005509 AAATAGAGAGAGATGGAGAGAGG - Intergenic
1047191975 8:122686611-122686633 AAATAGACAGAAATGGACAAAGG - Intergenic
1047217811 8:122892500-122892522 AAACAATAAGAGAGGAAGAAAGG - Intronic
1047313211 8:123709469-123709491 AATAAATCAGAGCTAGAGAATGG - Intronic
1048433783 8:134396136-134396158 AAATGGTCAGAGAGGTAGAAAGG - Intergenic
1048474078 8:134727444-134727466 CAATGATCAGAGAGAGAGAAAGG - Intergenic
1049878143 8:145041056-145041078 AAATTATCAGGGATAAAGAAGGG - Intergenic
1050923345 9:11233816-11233838 GACAAATCAGACATGGAGAAAGG + Intergenic
1050966652 9:11812634-11812656 AGATTATCAGAGACTGAGAAAGG - Intergenic
1051016047 9:12476355-12476377 AAATCATGACAGATGGTGAAGGG - Intergenic
1051037555 9:12766892-12766914 AAAAAATCAGAGACGGAGAATGG + Intergenic
1051106513 9:13587030-13587052 AAAGAAAGAGAGAAGGAGAATGG - Intergenic
1051795062 9:20858454-20858476 ATAAAATCAGAGATGAAAAAGGG - Intronic
1051994414 9:23197654-23197676 AGAGAAATAGAGATGGAGAAGGG - Intergenic
1052065319 9:24011308-24011330 AAATAGTCAGAGAGGGAAGACGG - Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1052811770 9:33067380-33067402 TAAGAATCAGAGGTGGAGAAGGG + Intronic
1053025994 9:34728816-34728838 AAATAAGCAGAGAAGGAAAATGG - Intronic
1053037500 9:34837856-34837878 AAATAAGCAGAGAAGGAAAATGG - Intergenic
1053047139 9:34929128-34929150 AAATATTCAGATAGGGAGAAGGG - Intergenic
1053554883 9:39125718-39125740 AAATTATCAGAGATGAAAAAGGG + Intronic
1053819000 9:41945974-41945996 AAATTATCAGAGATGAAAAAGGG + Intronic
1054109265 9:61089626-61089648 AAATTATCCGAGATGAAAAAGGG + Intergenic
1054611592 9:67241499-67241521 AAATTATCCGAGATGAAAAAGGG - Intergenic
1054925745 9:70587265-70587287 AAATACTCAGAGAAGCAGAAAGG + Intronic
1054988488 9:71292002-71292024 AAATAATGAAAGACGGAAAAAGG + Intronic
1055796708 9:79982394-79982416 CAATATTCAAAGATGGGGAAAGG - Intergenic
1055837028 9:80455739-80455761 ACATAAGCAGAGATGGGGATAGG + Intergenic
1056008455 9:82300288-82300310 AAACAATAAGAGAAGGAGAAAGG - Intergenic
1056161014 9:83893910-83893932 AAATAATCAGGAATGAAAAAGGG + Intronic
1056349576 9:85736006-85736028 AAATGAGCAGAGATTAAGAAGGG + Intronic
1056359115 9:85835338-85835360 AAATAATCAGGAATGAAAAAGGG - Intergenic
1056411232 9:86329573-86329595 AAATAATATGGGATGGAGTATGG + Intronic
1056886427 9:90448209-90448231 ACATAATCAGAGATTGTGAGTGG - Intergenic
1056911590 9:90706100-90706122 AAATAATCACAGGAGGAAAAAGG + Intergenic
1056937798 9:90930779-90930801 AAATAATCTAATATGGAGGAGGG + Intergenic
1057022324 9:91709092-91709114 AAATATTCAGAGATAATGAAGGG - Intronic
1057375899 9:94522706-94522728 AAATGATCAGAGATAAAGAGGGG - Intergenic
1058087764 9:100767567-100767589 AAACAATTAGAAATGGTGAAGGG - Intergenic
1058275474 9:103036540-103036562 TATTAATGAGAGAGGGAGAAAGG - Intergenic
1058291818 9:103251928-103251950 AAATTATCAAAGATGAACAAAGG + Intergenic
1058403952 9:104650369-104650391 ATATACACAGAGATGGAGAATGG + Intergenic
1058463211 9:105202567-105202589 AAATAATCAGAAATGCAGGGGGG + Intergenic
1058487471 9:105456908-105456930 AGATAAACAGAGATGAATAAAGG - Intronic
1058488169 9:105463209-105463231 ATATAATCAGATATCGACAAAGG - Intronic
1059167812 9:112095745-112095767 AAAGAGTCAGAAATGGAGACAGG + Intronic
1059578363 9:115516870-115516892 GAATCAGCAGAGAAGGAGAATGG - Intergenic
1060488946 9:124067881-124067903 AAAAAAAAAGAGATGGGGAAGGG - Intergenic
1060769469 9:126321351-126321373 AAATTATTAGACATGGACAAAGG + Intergenic
1062089885 9:134670254-134670276 AAATAATCAGAGAGACAGAAAGG - Intronic
1203618258 Un_KI270749v1:89889-89911 CAGGAATCAGAAATGGAGAAAGG + Intergenic
1185956833 X:4500240-4500262 AAATAAACATAAATGTAGAAGGG + Intergenic
1186006900 X:5082031-5082053 GAATATTGATAGATGGAGAAAGG - Intergenic
1186444695 X:9617234-9617256 AAATGATCAGAGACGCACAATGG - Intronic
1186590690 X:10926990-10927012 TAATAATAAGATATGAAGAATGG + Intergenic
1187567349 X:20464626-20464648 AAATAAATAGAGATGGGAAAAGG + Intergenic
1187641039 X:21290008-21290030 ACATAATCAGAGATGACAAAGGG - Intergenic
1187680512 X:21762555-21762577 AAAAAATAACAGATGAAGAATGG + Intergenic
1187787923 X:22914167-22914189 AAATAATTAGTGTGGGAGAAGGG + Intergenic
1188897011 X:35681219-35681241 AATTAGTCAGAAATAGAGAATGG + Intergenic
1189411251 X:40773936-40773958 AAATAATAAAGGAAGGAGAAGGG + Intergenic
1189613740 X:42764046-42764068 AACAAATCAGGCATGGAGAAAGG - Intergenic
1190531200 X:51378378-51378400 AAATAATCAAAGAGCTAGAATGG + Intergenic
1190536835 X:51437389-51437411 AAAGAATGAGATATGGAGTATGG + Intergenic
1191164201 X:57370130-57370152 AAAAAATGAGAGGTGAAGAAAGG + Intronic
1191652507 X:63555808-63555830 AAAGAATGAGAGAATGAGAAGGG - Intergenic
1192249966 X:69403809-69403831 AAACAATCTGTGATGGAAAAAGG - Intergenic
1192373080 X:70531835-70531857 AGATATTCAGAGAAAGAGAAGGG + Intronic
1192619556 X:72664004-72664026 AAACAATAAGAGAGGAAGAAAGG + Intronic
1193199188 X:78667551-78667573 AAATAATCAGAAACTAAGAAGGG - Intergenic
1193338074 X:80313721-80313743 CACAAATCAGACATGGAGAAGGG - Intergenic
1193756378 X:85414071-85414093 ATATAATCAGAAATGAAAAAGGG - Intergenic
1193844321 X:86449566-86449588 AGACAATAAGAGATGAAGAAAGG - Intronic
1193892022 X:87059897-87059919 GAATAATCAGAGCAGGAGAAAGG + Intergenic
1193909917 X:87291463-87291485 AAATAAATGGAGATGGAGACTGG - Intergenic
1194019892 X:88674708-88674730 AAATAATGAGAGAAAGAAAATGG + Intergenic
1194825127 X:98552503-98552525 ATAGAATAAGAGAAGGAGAATGG + Intergenic
1195602190 X:106762301-106762323 AAAAAATCAAAAGTGGAGAATGG - Intronic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1196361934 X:114871551-114871573 AAATAATCAATGAGAGAGAAAGG - Intronic
1196484844 X:116194297-116194319 CAATAATAAGTAATGGAGAAAGG + Intergenic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1197021401 X:121693959-121693981 AAATATACGGAGATGAAGAAAGG - Intergenic
1197373715 X:125656824-125656846 AAAAAATAAAAAATGGAGAAAGG + Intergenic
1197622016 X:128761442-128761464 AAATAATAAAAGCTAGAGAATGG - Intergenic
1197887340 X:131232159-131232181 AAATATTTGGAGATGGAGAGAGG + Intergenic
1197937853 X:131758629-131758651 AAAAAAACAGAGAGAGAGAATGG - Intergenic
1197962951 X:132024929-132024951 AAATAAAGAGAGAGAGAGAAAGG + Intergenic
1198475193 X:136989738-136989760 AAATAATTAGAGATTGACATAGG + Intergenic
1198528395 X:137525043-137525065 AAATAATCCAAGATTGAGATGGG - Intergenic
1198695180 X:139328641-139328663 ATAAAATCAGAAATGGAAAAGGG + Intergenic
1199243055 X:145570698-145570720 AAACAATCAGAGAGAAAGAAAGG + Intergenic
1199282013 X:146012894-146012916 CAATAATAAGCAATGGAGAAAGG + Intergenic
1199333988 X:146597077-146597099 ATAAATTCAGAGATGGAAAAGGG - Intergenic
1200590568 Y:5069241-5069263 AAAAAAACAGACATGGAAAACGG + Intronic
1200959252 Y:8982107-8982129 TTTAAATCAGAGATGGAGAAGGG - Intergenic
1201312108 Y:12606480-12606502 TTTAAATCAGAGATGGAGAAGGG + Intergenic
1201630196 Y:16063388-16063410 GACAAATCAGACATGGAGAAAGG + Intergenic
1201859640 Y:18582708-18582730 ACATAATCAGAGCTCAAGAAAGG - Intronic
1201873681 Y:18737673-18737695 ACATAATCAGAGCTCAAGAAAGG + Intronic