ID: 926677231

View in Genome Browser
Species Human (GRCh38)
Location 2:15636095-15636117
Sequence GGATGGGTGCAAAGGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926677231_926677238 21 Left 926677231 2:15636095-15636117 CCTTGTGTCCTTTGCACCCATCC No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data
926677231_926677235 -4 Left 926677231 2:15636095-15636117 CCTTGTGTCCTTTGCACCCATCC No data
Right 926677235 2:15636114-15636136 ATCCAAGCCAATGTGTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926677231 Original CRISPR GGATGGGTGCAAAGGACACA AGG (reversed) Intergenic
No off target data available for this crispr