ID: 926677233

View in Genome Browser
Species Human (GRCh38)
Location 2:15636111-15636133
Sequence TAAGACACATTGGCTTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926677233_926677238 5 Left 926677233 2:15636111-15636133 CCCATCCAAGCCAATGTGTCTTA No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926677233 Original CRISPR TAAGACACATTGGCTTGGAT GGG (reversed) Intergenic
No off target data available for this crispr