ID: 926677234

View in Genome Browser
Species Human (GRCh38)
Location 2:15636112-15636134
Sequence TTAAGACACATTGGCTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926677234_926677238 4 Left 926677234 2:15636112-15636134 CCATCCAAGCCAATGTGTCTTAA No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926677234 Original CRISPR TTAAGACACATTGGCTTGGA TGG (reversed) Intergenic
No off target data available for this crispr