ID: 926677236

View in Genome Browser
Species Human (GRCh38)
Location 2:15636116-15636138
Sequence AACCTTAAGACACATTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926677236_926677242 28 Left 926677236 2:15636116-15636138 CCAAGCCAATGTGTCTTAAGGTT No data
Right 926677242 2:15636167-15636189 TTGTTGAAATATTATGTAGTGGG No data
926677236_926677241 27 Left 926677236 2:15636116-15636138 CCAAGCCAATGTGTCTTAAGGTT No data
Right 926677241 2:15636166-15636188 CTTGTTGAAATATTATGTAGTGG No data
926677236_926677243 29 Left 926677236 2:15636116-15636138 CCAAGCCAATGTGTCTTAAGGTT No data
Right 926677243 2:15636168-15636190 TGTTGAAATATTATGTAGTGGGG No data
926677236_926677238 0 Left 926677236 2:15636116-15636138 CCAAGCCAATGTGTCTTAAGGTT No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926677236 Original CRISPR AACCTTAAGACACATTGGCT TGG (reversed) Intergenic
No off target data available for this crispr