ID: 926677238

View in Genome Browser
Species Human (GRCh38)
Location 2:15636139-15636161
Sequence ACATATAGTCAGACTCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926677232_926677238 13 Left 926677232 2:15636103-15636125 CCTTTGCACCCATCCAAGCCAAT No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data
926677231_926677238 21 Left 926677231 2:15636095-15636117 CCTTGTGTCCTTTGCACCCATCC No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data
926677236_926677238 0 Left 926677236 2:15636116-15636138 CCAAGCCAATGTGTCTTAAGGTT No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data
926677233_926677238 5 Left 926677233 2:15636111-15636133 CCCATCCAAGCCAATGTGTCTTA No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data
926677237_926677238 -5 Left 926677237 2:15636121-15636143 CCAATGTGTCTTAAGGTTACATA No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data
926677234_926677238 4 Left 926677234 2:15636112-15636134 CCATCCAAGCCAATGTGTCTTAA No data
Right 926677238 2:15636139-15636161 ACATATAGTCAGACTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926677238 Original CRISPR ACATATAGTCAGACTCAAGC TGG Intergenic
No off target data available for this crispr