ID: 926681202

View in Genome Browser
Species Human (GRCh38)
Location 2:15665359-15665381
Sequence CAGCAGGAACAGAGTGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926681198_926681202 1 Left 926681198 2:15665335-15665357 CCCTGTGTGGAGGTGACAAGGAA No data
Right 926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG No data
926681195_926681202 12 Left 926681195 2:15665324-15665346 CCTCTCTAGAGCCCTGTGTGGAG No data
Right 926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG No data
926681199_926681202 0 Left 926681199 2:15665336-15665358 CCTGTGTGGAGGTGACAAGGAAG No data
Right 926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926681202 Original CRISPR CAGCAGGAACAGAGTGACCA GGG Intergenic
No off target data available for this crispr