ID: 926693108

View in Genome Browser
Species Human (GRCh38)
Location 2:15750998-15751020
Sequence CTCGTCCTGGATACTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926693108_926693122 28 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693122 2:15751049-15751071 GGATTCCAGCCTGGGATCCTAGG No data
926693108_926693120 19 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693120 2:15751040-15751062 GGATTGACAGGATTCCAGCCTGG No data
926693108_926693116 -3 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693116 2:15751018-15751040 GAGGCCTAACTGAAGGGAGGAGG No data
926693108_926693121 20 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693121 2:15751041-15751063 GATTGACAGGATTCCAGCCTGGG No data
926693108_926693117 -2 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693117 2:15751019-15751041 AGGCCTAACTGAAGGGAGGAGGG No data
926693108_926693113 -10 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693113 2:15751011-15751033 CCAGGACGAGGCCTAACTGAAGG No data
926693108_926693119 7 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693119 2:15751028-15751050 TGAAGGGAGGAGGGATTGACAGG No data
926693108_926693114 -9 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693114 2:15751012-15751034 CAGGACGAGGCCTAACTGAAGGG No data
926693108_926693115 -6 Left 926693108 2:15750998-15751020 CCAGACCCAGTATCCAGGACGAG No data
Right 926693115 2:15751015-15751037 GACGAGGCCTAACTGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926693108 Original CRISPR CTCGTCCTGGATACTGGGTC TGG (reversed) Intergenic
No off target data available for this crispr