ID: 926694727

View in Genome Browser
Species Human (GRCh38)
Location 2:15763305-15763327
Sequence ACCAGGGCACTGAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926694721_926694727 24 Left 926694721 2:15763258-15763280 CCAGGGGAATCTGGATTCTAACT No data
Right 926694727 2:15763305-15763327 ACCAGGGCACTGAGGGAAATAGG No data
926694720_926694727 25 Left 926694720 2:15763257-15763279 CCCAGGGGAATCTGGATTCTAAC No data
Right 926694727 2:15763305-15763327 ACCAGGGCACTGAGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926694727 Original CRISPR ACCAGGGCACTGAGGGAAAT AGG Intergenic
No off target data available for this crispr