ID: 926698770

View in Genome Browser
Species Human (GRCh38)
Location 2:15788694-15788716
Sequence GGGCAGAGGCCGGGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698770_926698784 21 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698770_926698778 -2 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698778 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data
926698770_926698785 26 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698785 2:15788743-15788765 TCTAATCGGACCACTTGGTGTGG No data
926698770_926698783 12 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698770_926698775 -5 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698775 2:15788712-15788734 TGCCCCCGGATGCCTCACTCTGG No data
926698770_926698781 2 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698781 2:15788719-15788741 GGATGCCTCACTCTGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698770 Original CRISPR GGGCAGAGGCCGGGCAGTGA TGG (reversed) Intergenic