ID: 926698772

View in Genome Browser
Species Human (GRCh38)
Location 2:15788703-15788725
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698772_926698787 24 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698787 2:15788750-15788772 GGACCACTTGGTGTGGAGACGGG No data
926698772_926698785 17 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698785 2:15788743-15788765 TCTAATCGGACCACTTGGTGTGG No data
926698772_926698783 3 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698772_926698789 26 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698772_926698786 23 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698786 2:15788749-15788771 CGGACCACTTGGTGTGGAGACGG No data
926698772_926698781 -7 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698781 2:15788719-15788741 GGATGCCTCACTCTGGTGGCTGG No data
926698772_926698784 12 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698772_926698788 25 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698788 2:15788751-15788773 GACCACTTGGTGTGGAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698772 Original CRISPR GGCATCCGGGGGCAGAGGCC GGG (reversed) Intergenic