ID: 926698773

View in Genome Browser
Species Human (GRCh38)
Location 2:15788704-15788726
Sequence AGGCATCCGGGGGCAGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698773_926698781 -8 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698781 2:15788719-15788741 GGATGCCTCACTCTGGTGGCTGG No data
926698773_926698786 22 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698786 2:15788749-15788771 CGGACCACTTGGTGTGGAGACGG No data
926698773_926698788 24 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698788 2:15788751-15788773 GACCACTTGGTGTGGAGACGGGG No data
926698773_926698785 16 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698785 2:15788743-15788765 TCTAATCGGACCACTTGGTGTGG No data
926698773_926698787 23 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698787 2:15788750-15788772 GGACCACTTGGTGTGGAGACGGG No data
926698773_926698784 11 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698773_926698789 25 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698773_926698783 2 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698773 Original CRISPR AGGCATCCGGGGGCAGAGGC CGG (reversed) Intergenic