ID: 926698774

View in Genome Browser
Species Human (GRCh38)
Location 2:15788708-15788730
Sequence AGTGAGGCATCCGGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698774_926698785 12 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698785 2:15788743-15788765 TCTAATCGGACCACTTGGTGTGG No data
926698774_926698788 20 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698788 2:15788751-15788773 GACCACTTGGTGTGGAGACGGGG No data
926698774_926698791 27 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data
926698774_926698787 19 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698787 2:15788750-15788772 GGACCACTTGGTGTGGAGACGGG No data
926698774_926698784 7 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698774_926698783 -2 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698774_926698786 18 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698786 2:15788749-15788771 CGGACCACTTGGTGTGGAGACGG No data
926698774_926698789 21 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698774 Original CRISPR AGTGAGGCATCCGGGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr