ID: 926698776

View in Genome Browser
Species Human (GRCh38)
Location 2:15788714-15788736
Sequence CACCAGAGTGAGGCATCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698776_926698785 6 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698785 2:15788743-15788765 TCTAATCGGACCACTTGGTGTGG No data
926698776_926698783 -8 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698776_926698791 21 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data
926698776_926698786 12 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698786 2:15788749-15788771 CGGACCACTTGGTGTGGAGACGG No data
926698776_926698788 14 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698788 2:15788751-15788773 GACCACTTGGTGTGGAGACGGGG No data
926698776_926698789 15 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698776_926698787 13 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698787 2:15788750-15788772 GGACCACTTGGTGTGGAGACGGG No data
926698776_926698784 1 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698776 Original CRISPR CACCAGAGTGAGGCATCCGG GGG (reversed) Intergenic