ID: 926698778

View in Genome Browser
Species Human (GRCh38)
Location 2:15788715-15788737
Sequence CCCCGGATGCCTCACTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698770_926698778 -2 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698778 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data
926698763_926698778 28 Left 926698763 2:15788664-15788686 CCCTGTGTATGCGTCCTTGGATG No data
Right 926698778 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data
926698768_926698778 14 Left 926698768 2:15788678-15788700 CCTTGGATGGGGTTATCCATCAC No data
Right 926698778 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data
926698764_926698778 27 Left 926698764 2:15788665-15788687 CCTGTGTATGCGTCCTTGGATGG No data
Right 926698778 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698778 Original CRISPR CCCCGGATGCCTCACTCTGG TGG Intergenic