ID: 926698780

View in Genome Browser
Species Human (GRCh38)
Location 2:15788717-15788739
Sequence AGCCACCAGAGTGAGGCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698780_926698789 12 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698780_926698784 -2 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698780_926698787 10 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698787 2:15788750-15788772 GGACCACTTGGTGTGGAGACGGG No data
926698780_926698786 9 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698786 2:15788749-15788771 CGGACCACTTGGTGTGGAGACGG No data
926698780_926698785 3 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698785 2:15788743-15788765 TCTAATCGGACCACTTGGTGTGG No data
926698780_926698791 18 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data
926698780_926698788 11 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698788 2:15788751-15788773 GACCACTTGGTGTGGAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698780 Original CRISPR AGCCACCAGAGTGAGGCATC CGG (reversed) Intergenic