ID: 926698781

View in Genome Browser
Species Human (GRCh38)
Location 2:15788719-15788741
Sequence GGATGCCTCACTCTGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698770_926698781 2 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698781 2:15788719-15788741 GGATGCCTCACTCTGGTGGCTGG No data
926698773_926698781 -8 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698781 2:15788719-15788741 GGATGCCTCACTCTGGTGGCTGG No data
926698772_926698781 -7 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698781 2:15788719-15788741 GGATGCCTCACTCTGGTGGCTGG No data
926698768_926698781 18 Left 926698768 2:15788678-15788700 CCTTGGATGGGGTTATCCATCAC No data
Right 926698781 2:15788719-15788741 GGATGCCTCACTCTGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698781 Original CRISPR GGATGCCTCACTCTGGTGGC TGG Intergenic