ID: 926698783

View in Genome Browser
Species Human (GRCh38)
Location 2:15788729-15788751
Sequence CTCTGGTGGCTGGCTCTAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698773_926698783 2 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698768_926698783 28 Left 926698768 2:15788678-15788700 CCTTGGATGGGGTTATCCATCAC No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698772_926698783 3 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698776_926698783 -8 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698770_926698783 12 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698777_926698783 -9 Left 926698777 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698779_926698783 -10 Left 926698779 2:15788716-15788738 CCCGGATGCCTCACTCTGGTGGC No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data
926698774_926698783 -2 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698783 2:15788729-15788751 CTCTGGTGGCTGGCTCTAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698783 Original CRISPR CTCTGGTGGCTGGCTCTAAT CGG Intergenic