ID: 926698784

View in Genome Browser
Species Human (GRCh38)
Location 2:15788738-15788760
Sequence CTGGCTCTAATCGGACCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698777_926698784 0 Left 926698777 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698770_926698784 21 Left 926698770 2:15788694-15788716 CCATCACTGCCCGGCCTCTGCCC No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698782_926698784 -9 Left 926698782 2:15788724-15788746 CCTCACTCTGGTGGCTGGCTCTA No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698773_926698784 11 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698774_926698784 7 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698780_926698784 -2 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698772_926698784 12 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698776_926698784 1 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data
926698779_926698784 -1 Left 926698779 2:15788716-15788738 CCCGGATGCCTCACTCTGGTGGC No data
Right 926698784 2:15788738-15788760 CTGGCTCTAATCGGACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698784 Original CRISPR CTGGCTCTAATCGGACCACT TGG Intergenic