ID: 926698789

View in Genome Browser
Species Human (GRCh38)
Location 2:15788752-15788774
Sequence ACCACTTGGTGTGGAGACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698782_926698789 5 Left 926698782 2:15788724-15788746 CCTCACTCTGGTGGCTGGCTCTA No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698777_926698789 14 Left 926698777 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698774_926698789 21 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698776_926698789 15 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698780_926698789 12 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698773_926698789 25 Left 926698773 2:15788704-15788726 CCGGCCTCTGCCCCCGGATGCCT No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698772_926698789 26 Left 926698772 2:15788703-15788725 CCCGGCCTCTGCCCCCGGATGCC No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data
926698779_926698789 13 Left 926698779 2:15788716-15788738 CCCGGATGCCTCACTCTGGTGGC No data
Right 926698789 2:15788752-15788774 ACCACTTGGTGTGGAGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698789 Original CRISPR ACCACTTGGTGTGGAGACGG GGG Intergenic
No off target data available for this crispr